Morpholino

MO1-meis1b

ID

ZDB-MRPHLNO-071025-2

Name

MO1-meis1b

Previous Names

meis1.1MO (1)

Target

meis1b (1)

Sequence

5' - ATGGCGCAGAGGTACGAAGATATAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

targeted to translation-start

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-meis1b

Expressed Gene	Anatomy	Figures
aldh1a2	presumptive neural retina	Fig. 4 from French et al., 2007
ccnd1	optic vesicle	Fig. 3 , Fig. S5 from Bessa et al., 2008
dusp6	optic vesicle	Fig. 7 from Erickson et al., 2010
efna2a	cerebellum midbrain hindbrain boundary optic tectum	Fig. 2 from Erickson et al., 2010
efna3b	cerebellum midbrain hindbrain boundary optic tectum	Fig. 2 from Erickson et al., 2010
efna5a	cerebellum midbrain hindbrain boundary optic cup medial region optic tectum	Fig. 2 , Fig. 8 from Erickson et al., 2010
efnb2a	optic cup dorsal region	Fig. 3 from Erickson et al., 2010
efnb3b	optic tectum	Fig. 2 from Erickson et al., 2010
egr2b	rhombomere 3 rhombomere 5	Fig. S2 from Bessa et al., 2008
epha3	optic cup lateral region	Fig. 8 from Erickson et al., 2010
ephb2a	(not) dorsal aorta optic cup ventral region	Fig. S9 from Cvejic et al., 2011 Fig. 3 from Erickson et al., 2010
foxd1	optic cup lateral region optic vesicle lateral region	Fig. 6 from Erickson et al., 2010
foxg1a	optic cup medial region optic vesicle medial region	Fig. 6 from Erickson et al., 2010
fsta	brain immature eye neural rod optic vesicle spinal cord neural rod anterior region spinal cord neural tube anterior region	Fig. 5 from Erickson et al., 2010
hoxa2b	hindbrain	Fig. 4 from French et al., 2007
il17rd	optic vesicle	Fig. 7 from Erickson et al., 2010
myb	dorsal aorta intermediate cell mass of mesoderm	Fig. 4 from Cvejic et al., 2011
myca	optic vesicle	Fig. 3 from Bessa et al., 2008
pax6b	optic vesicle	Fig. S4 from Bessa et al., 2008
rag1	(not) thymus	Fig. S7 from Cvejic et al., 2011
smad1	optic vesicle	Fig. 4 from Erickson et al., 2010
tbx5a	optic cup dorsal region optic vesicle dorsal region	Fig. 3 , Fig. 4 from Erickson et al., 2010
tshz3b	hindbrain	Fig. 2 from Erickson et al., 2011
vax2	optic cup ventral region optic vesicle ventral region	Fig. 3 from Erickson et al., 2010

Phenotype

Phenotype resulting from MO1-meis1b

Phenotype	Fish	Figures
blood cell decreased amount, abnormal	WT + MO1-meis1b	Fig. 2 from Cvejic et al., 2011
blood island macrophage decreased amount, abnormal	y1Tg + MO1-meis1b	Fig. S7 from Cvejic et al., 2011
blood island neutrophil decreased amount, abnormal	WT + MO1-meis1b	Fig. S7 from Cvejic et al., 2011
blood vessel lumenization disrupted, abnormal	y1Tg + MO1-meis1b	Fig. S8 from Cvejic et al., 2011
dorsal aorta fused with posterior cardinal vein, abnormal	y1Tg + MO1-meis1b	Fig. S8 from Cvejic et al., 2011
dorsal/ventral pattern formation disrupted, abnormal	AB + MO1-meis1b	Fig. 3 , Fig. 4 from Erickson et al., 2010
embryonic pattern specification disrupted, abnormal	AB + MO1-meis1b	Fig. 10 from Erickson et al., 2010
embryonic retina morphogenesis in camera-type eye disrupted, abnormal	AB + MO1-meis1b	Fig. 4 , Fig. 6 , Fig. 10 from Erickson et al., 2010
erythrocyte differentiation disrupted, abnormal	WT + MO1-meis1b	Fig. 3 from Cvejic et al., 2011
eye decreased size, abnormal	WT + MO1-meis1b	Fig. 2 from Bessa et al., 2008
heart contraction decreased rate, abnormal	WT + MO1-meis1b	Fig. SMovie4 from Cvejic et al., 2011
hemopoiesis decreased process quality, abnormal	la2Tg + MO1-meis1b	Fig. 4 from Cvejic et al., 2011
hindbrain tshz3b expression decreased amount, abnormal	AB + MO1-meis1b	Fig. 2 from Erickson et al., 2011
hindbrain morphology, abnormal	WT + MO1-meis1b	Fig. 4 from French et al., 2007
nucleate erythrocyte decreased amount, abnormal	WT + MO1-meis1b	Fig. 2 from Cvejic et al., 2011
optic cup wholly ventralized, abnormal	AB + MO1-meis1b	Fig. 3 from Erickson et al., 2010
optic tectum decreased size, abnormal	AB + MO1-meis1b	Fig. 9 from Erickson et al., 2010
optic tectum grey matter decreased mass, abnormal	AB + MO1-meis1b	Fig. 9 from Erickson et al., 2010
regulation of fibroblast growth factor receptor signaling pathway disrupted, abnormal	AB + MO1-meis1b	Fig. 7 , Fig. 8 from Erickson et al., 2010
retina morphology, abnormal	WT + MO1-meis1b	Fig. 4 from French et al., 2007
selective angioblast sprouting disrupted, abnormal	y1Tg + MO1-meis1b	Fig. S8 from Cvejic et al., 2011
thrombocyte absent, abnormal	la2Tg + MO1-meis1b	Fig. 4 from Cvejic et al., 2011

Phenotype of all Fish created by or utilizing MO1-meis1b

Phenotype	Fish	Conditions	Figures
optic tectum grey matter decreased mass, abnormal	AB + MO1-meis1b	standard conditions	Fig. 9 from Erickson et al., 2010
hindbrain tshz3b expression decreased amount, abnormal	AB + MO1-meis1b	control	Fig. 2 from Erickson et al., 2011
optic cup wholly ventralized, abnormal	AB + MO1-meis1b	standard conditions	Fig. 3 from Erickson et al., 2010
embryonic retina morphogenesis in camera-type eye disrupted, abnormal	AB + MO1-meis1b	standard conditions	Fig. 4 , Fig. 6 , Fig. 10 from Erickson et al., 2010
regulation of fibroblast growth factor receptor signaling pathway disrupted, abnormal	AB + MO1-meis1b	standard conditions	Fig. 7 , Fig. 8 from Erickson et al., 2010
optic tectum decreased size, abnormal	AB + MO1-meis1b	standard conditions	Fig. 9 from Erickson et al., 2010
dorsal/ventral pattern formation disrupted, abnormal	AB + MO1-meis1b	standard conditions	Fig. 3 , Fig. 4 from Erickson et al., 2010
embryonic pattern specification disrupted, abnormal	AB + MO1-meis1b	standard conditions	Fig. 10 from Erickson et al., 2010
eye decreased size, abnormal	WT + MO1-meis1b	standard conditions	Fig. 2 from Bessa et al., 2008
blood cell decreased amount, abnormal	WT + MO1-meis1b	standard conditions	Fig. 2 from Cvejic et al., 2011
retina morphology, abnormal	WT + MO1-meis1b	standard conditions	Fig. 4 from French et al., 2007
heart contraction decreased rate, abnormal	WT + MO1-meis1b	standard conditions	Fig. SMovie4 from Cvejic et al., 2011
blood island neutrophil decreased amount, abnormal	WT + MO1-meis1b	standard conditions	Fig. S7 from Cvejic et al., 2011
nucleate erythrocyte decreased amount, abnormal	WT + MO1-meis1b	standard conditions	Fig. 2 from Cvejic et al., 2011
hindbrain morphology, abnormal	WT + MO1-meis1b	standard conditions	Fig. 4 from French et al., 2007
erythrocyte differentiation disrupted, abnormal	WT + MO1-meis1b	standard conditions	Fig. 3 from Cvejic et al., 2011
thrombocyte absent, abnormal	la2Tg + MO1-meis1b	standard conditions	Fig. 4 from Cvejic et al., 2011
hemopoiesis decreased process quality, abnormal	la2Tg + MO1-meis1b	standard conditions	Fig. 4 from Cvejic et al., 2011
dorsal aorta fused with posterior cardinal vein, abnormal	y1Tg + MO1-meis1b	standard conditions	Fig. S8 from Cvejic et al., 2011
blood vessel lumenization disrupted, abnormal	y1Tg + MO1-meis1b	standard conditions	Fig. S8 from Cvejic et al., 2011
selective angioblast sprouting disrupted, abnormal	y1Tg + MO1-meis1b	standard conditions	Fig. S8 from Cvejic et al., 2011
blood island macrophage decreased amount, abnormal	y1Tg + MO1-meis1b	standard conditions	Fig. S7 from Cvejic et al., 2011
dorsal/ventral pattern formation disrupted, abnormal	AB + MO1-meis1b + MO3-smad5	standard conditions	Fig. 4 from Erickson et al., 2010
embryonic retina morphogenesis in camera-type eye disrupted, abnormal	AB + MO1-meis1b + MO3-smad5	standard conditions	Fig. 4 from Erickson et al., 2010
myeloid cell lcp1 expression decreased amount, abnormal	hsi1Tg; zdf13Tg + MO1-meis1b	heat shock	Fig. 2 from Deveau et al., 2015
hemopoiesis process quality, ameliorated	hsi1Tg; zdf13Tg + MO1-meis1b	heat shock	Fig. 2 from Deveau et al., 2015
dorsal aorta hematopoietic stem cell runx1 expression amount, ameliorated	hsi1Tg; zdf13Tg + MO1-meis1b	heat shock	Fig. 2 from Deveau et al., 2015
dorsal aorta hematopoietic stem cell myb expression amount, ameliorated	hsi1Tg; zdf13Tg + MO1-meis1b	heat shock	Fig. 2 from Deveau et al., 2015

Citations