Community Action Needed: Please respond to the NIH RFI
Morpholino

MO1-meis1b

ID
ZDB-MRPHLNO-071025-2
Name
MO1-meis1b
Previous Names
  • meis1.1MO (1)
Target
Sequence
5' - ATGGCGCAGAGGTACGAAGATATAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targeted to translation-start
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-meis1b
Expressed Gene Anatomy Figures
aldh1a2 Fig. 4 with image from French et al., 2007
ccnd1 Fig. 3 with imageFig. S5 with image from Bessa et al., 2008
dusp6 Fig. 7 with image from Erickson et al., 2010
efna2a Fig. 2 with image from Erickson et al., 2010
efna3b Fig. 2 with image from Erickson et al., 2010
efna5a Fig. 2 with imageFig. 8 with image from Erickson et al., 2010
efnb2a Fig. 3 with image from Erickson et al., 2010
efnb3b Fig. 2 with image from Erickson et al., 2010
egr2b Fig. S2 with image from Bessa et al., 2008
epha3 Fig. 8 with image from Erickson et al., 2010
ephb2a Fig. S9 from Cvejic et al., 2011
Fig. 3 with image from Erickson et al., 2010
foxd1 Fig. 6 with image from Erickson et al., 2010
foxg1a Fig. 6 with image from Erickson et al., 2010
fsta Fig. 5 with image from Erickson et al., 2010
hoxa2b Fig. 4 with image from French et al., 2007
il17rd Fig. 7 with image from Erickson et al., 2010
myb Fig. 4 from Cvejic et al., 2011
myca Fig. 3 with image from Bessa et al., 2008
pax6b Fig. S4 with image from Bessa et al., 2008
rag1 Fig. S7 from Cvejic et al., 2011
smad1 Fig. 4 with image from Erickson et al., 2010
tbx5a Fig. 3 with imageFig. 4 with image from Erickson et al., 2010
tshz3b Fig. 2 from Erickson et al., 2011
vax2 Fig. 3 with image from Erickson et al., 2010
Phenotype
Phenotype resulting from MO1-meis1b
Phenotype Fish Figures
blood cell decreased amount, abnormal WT + MO1-meis1b Fig. 2 from Cvejic et al., 2011
blood island macrophage decreased amount, abnormal y1Tg + MO1-meis1b Fig. S7 from Cvejic et al., 2011
blood island neutrophil decreased amount, abnormal WT + MO1-meis1b Fig. S7 from Cvejic et al., 2011
blood vessel lumenization disrupted, abnormal y1Tg + MO1-meis1b Fig. S8 from Cvejic et al., 2011
dorsal aorta fused with posterior cardinal vein, abnormal y1Tg + MO1-meis1b Fig. S8 from Cvejic et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-meis1b Fig. 3 with imageFig. 4 with image from Erickson et al., 2010
embryonic pattern specification disrupted, abnormal AB + MO1-meis1b Fig. 10 with image from Erickson et al., 2010
embryonic retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-meis1b Fig. 4 with imageFig. 6 with imageFig. 10 with image from Erickson et al., 2010
erythrocyte differentiation disrupted, abnormal WT + MO1-meis1b Fig. 3 from Cvejic et al., 2011
eye decreased size, abnormal WT + MO1-meis1b Fig. 2 with image from Bessa et al., 2008
heart contraction decreased rate, abnormal WT + MO1-meis1b Fig. SMovie4 from Cvejic et al., 2011
hemopoiesis decreased process quality, abnormal la2Tg + MO1-meis1b Fig. 4 from Cvejic et al., 2011
hindbrain tshz3b expression decreased amount, abnormal AB + MO1-meis1b Fig. 2 from Erickson et al., 2011
hindbrain morphology, abnormal WT + MO1-meis1b Fig. 4 with image from French et al., 2007
nucleate erythrocyte decreased amount, abnormal WT + MO1-meis1b Fig. 2 from Cvejic et al., 2011
optic cup wholly ventralized, abnormal AB + MO1-meis1b Fig. 3 with image from Erickson et al., 2010
optic tectum decreased size, abnormal AB + MO1-meis1b Fig. 9 with image from Erickson et al., 2010
optic tectum grey matter decreased mass, abnormal AB + MO1-meis1b Fig. 9 with image from Erickson et al., 2010
regulation of fibroblast growth factor receptor signaling pathway disrupted, abnormal AB + MO1-meis1b Fig. 7 with imageFig. 8 with image from Erickson et al., 2010
retina morphology, abnormal WT + MO1-meis1b Fig. 4 with image from French et al., 2007
selective angioblast sprouting disrupted, abnormal y1Tg + MO1-meis1b Fig. S8 from Cvejic et al., 2011
thrombocyte absent, abnormal la2Tg + MO1-meis1b Fig. 4 from Cvejic et al., 2011
Phenotype of all Fish created by or utilizing MO1-meis1b
Phenotype Fish Conditions Figures
optic tectum grey matter decreased mass, abnormal AB + MO1-meis1b standard conditions Fig. 9 with image from Erickson et al., 2010
hindbrain tshz3b expression decreased amount, abnormal AB + MO1-meis1b control Fig. 2 from Erickson et al., 2011
optic cup wholly ventralized, abnormal AB + MO1-meis1b standard conditions Fig. 3 with image from Erickson et al., 2010
embryonic retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-meis1b standard conditions Fig. 4 with imageFig. 6 with imageFig. 10 with image from Erickson et al., 2010
regulation of fibroblast growth factor receptor signaling pathway disrupted, abnormal AB + MO1-meis1b standard conditions Fig. 7 with imageFig. 8 with image from Erickson et al., 2010
optic tectum decreased size, abnormal AB + MO1-meis1b standard conditions Fig. 9 with image from Erickson et al., 2010
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-meis1b standard conditions Fig. 3 with imageFig. 4 with image from Erickson et al., 2010
embryonic pattern specification disrupted, abnormal AB + MO1-meis1b standard conditions Fig. 10 with image from Erickson et al., 2010
eye decreased size, abnormal WT + MO1-meis1b standard conditions Fig. 2 with image from Bessa et al., 2008
blood cell decreased amount, abnormal WT + MO1-meis1b standard conditions Fig. 2 from Cvejic et al., 2011
heart contraction decreased rate, abnormal WT + MO1-meis1b standard conditions Fig. SMovie4 from Cvejic et al., 2011
retina morphology, abnormal WT + MO1-meis1b standard conditions Fig. 4 with image from French et al., 2007
blood island neutrophil decreased amount, abnormal WT + MO1-meis1b standard conditions Fig. S7 from Cvejic et al., 2011
nucleate erythrocyte decreased amount, abnormal WT + MO1-meis1b standard conditions Fig. 2 from Cvejic et al., 2011
hindbrain morphology, abnormal WT + MO1-meis1b standard conditions Fig. 4 with image from French et al., 2007
erythrocyte differentiation disrupted, abnormal WT + MO1-meis1b standard conditions Fig. 3 from Cvejic et al., 2011
thrombocyte absent, abnormal la2Tg + MO1-meis1b standard conditions Fig. 4 from Cvejic et al., 2011
hemopoiesis decreased process quality, abnormal la2Tg + MO1-meis1b standard conditions Fig. 4 from Cvejic et al., 2011
dorsal aorta fused with posterior cardinal vein, abnormal y1Tg + MO1-meis1b standard conditions Fig. S8 from Cvejic et al., 2011
blood vessel lumenization disrupted, abnormal y1Tg + MO1-meis1b standard conditions Fig. S8 from Cvejic et al., 2011
selective angioblast sprouting disrupted, abnormal y1Tg + MO1-meis1b standard conditions Fig. S8 from Cvejic et al., 2011
blood island macrophage decreased amount, abnormal y1Tg + MO1-meis1b standard conditions Fig. S7 from Cvejic et al., 2011
myeloid cell lcp1 expression decreased amount, abnormal hsi1Tg; zdf13Tg + MO1-meis1b heat shock Fig. 2 from Deveau et al., 2015
hemopoiesis process quality, ameliorated hsi1Tg; zdf13Tg + MO1-meis1b heat shock Fig. 2 from Deveau et al., 2015
dorsal aorta hematopoietic stem cell runx1 expression amount, ameliorated hsi1Tg; zdf13Tg + MO1-meis1b heat shock Fig. 2 from Deveau et al., 2015
dorsal aorta hematopoietic stem cell myb expression amount, ameliorated hsi1Tg; zdf13Tg + MO1-meis1b heat shock Fig. 2 from Deveau et al., 2015
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-meis1b + MO3-smad5 standard conditions Fig. 4 with image from Erickson et al., 2010
embryonic retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-meis1b + MO3-smad5 standard conditions Fig. 4 with image from Erickson et al., 2010
Citations