Morpholino
MO2-ednraa
- ID
- ZDB-MRPHLNO-070829-2
- Name
- MO2-ednraa
- Previous Names
-
- ednra2 MO (1)
- MO2-ednra
- Target
- Sequence
-
5' - ATCAGACTTTTCTTTACCTGCTTAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
targets 6th, transmembrane domain; splice blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ednraa
No data available
Phenotype
Phenotype resulting from MO2-ednraa
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO2-ednraa
1 - 5 of 11 Show all
Citations
- Camargo-Sosa, K., Colanesi, S., Müller, J., Schulte-Merker, S., Stemple, D., Patton, E.E., Kelsh, R.N. (2019) Endothelin receptor Aa regulates proliferation and differentiation of Erb-dependent pigment progenitors in zebrafish. PLoS Genetics. 15:e1007941
- Gordon, C.T., Weaver, K.N., Zechi-Ceide, R.M., Madsen, E.C., Tavares, A.L., Oufadem, M., Kurihara, Y., Adameyko, I., Picard, A., Breton, S., Pierrot, S., Biosse-Duplan, M., Voisin, N., Masson, C., Bole-Feysot, C., Nitschké, P., Delrue, M.A., Lacombe, D., Guion-Almeida, M.L., Moura, P.P., Garib, D.G., Munnich, A., Ernfors, P., Hufnagel, R.B., Hopkin, R.J., Kurihara, H., Saal, H.M., Weaver, D.D., Katsanis, N., Lyonnet, S., Golzio, C., Clouthier, D.E., Amiel, J. (2015) Mutations in the endothelin receptor type A cause mandibulofacial dysostosis with alopecia. American journal of human genetics. 96:519-31
- Nair, S., Li, W., Cornell, R., and Schilling, T.F. (2007) Requirements for Endothelin type-A receptors and Endothelin-1 signaling in the facial ectoderm for the patterning of skeletogenic neural crest cells in zebrafish. Development (Cambridge, England). 134(2):335-345
1 - 3 of 3
Show