Morpholino
MO1-kcnh6a
- ID
- ZDB-MRPHLNO-070805-1
- Name
- MO1-kcnh6a
- Previous Names
-
- MO1-kcnh2 (1)
- Target
- Sequence
-
5' - CGCGTGGACAGATTCAAGAGCCCTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kcnh6a
No data available
Phenotype
Phenotype resulting from MO1-kcnh6a
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-kcnh6a
1 - 5 of 8 Show all
Citations
- Tanaka, Y., Hayashi, K., Fujino, N., Konno, T., Tada, H., Nakanishi, C., Hodatsu, A., Tsuda, T., Nagata, Y., Teramoto, R., Yoshida, S., Nomura, A., Kawashiri, M.A., Yamagishi, M. (2018) Functional analysis of KCNH2 gene mutations of type 2 long QT syndrome in larval zebrafish using microscopy and electrocardiography. Heart and vessels. 34(1):159-166
- Jou, C.J., Barnett, S.M., Bian, J.T., Weng, H.C., Sheng, X., and Tristani-Firouzi, M. (2013) An In Vivo Cardiac Assay to Determine the Functional Consequences of Putative Long QT Syndrome Mutations. Circulation research. 112(5):826-830
- Samson, S.C., Ferrer, T., Jou, C.J., Sachse, F.B., Shankaran, S.S., Shaw, R.M., Chi, N.C., Tristani-Firouzi, M., and Yost, H.J. (2013) 3-OST-7 regulates BMP-dependent cardiac contraction. PLoS Biology. 11(12):e1001727
- Arnaout, R., Ferrer, T., Huisken, J., Spitzer, K., Stainier, D.Y., Tristani-Firouzi, M., and Chi, N.C. (2007) Zebrafish model for human long QT syndrome. Proceedings of the National Academy of Sciences of the United States of America. 104(27):11316-11321
1 - 4 of 4
Show