Community Action Needed: Please respond to the NIH RFI
Morpholino

MO1-kcnip3b

ID
ZDB-MRPHLNO-070802-1
Name
MO1-kcnip3b
Previous Names
None
Target
Sequence
5' - CCCTTCTGTCCATCTGCCTGCATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targets first ATG of coding sequence
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kcnip3b
Phenotype
Phenotype resulting from MO1-kcnip3b
Phenotype of all Fish created by or utilizing MO1-kcnip3b
Citations