Morpholino
MO1-dnm2a
- ID
- ZDB-MRPHLNO-070713-2
- Name
- MO1-dnm2a
- Previous Names
-
- MO1-dnm2
- Target
- Sequence
-
5' - ATTCCTCCATCCCCCGGTTGCCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a corrected sequence for the zDnm1 morpholino in Kida et al., 2007.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dnm2a
Expressed Gene | Anatomy | Figures |
---|---|---|
myod1 |
Fig. 3 ![]() |
|
tbxta |
Fig. S9 ![]() |
1 - 2 of 2
Phenotype
Phenotype resulting from MO1-dnm2a
1 - 5 of 19 Show all
Phenotype of all Fish created by or utilizing MO1-dnm2a
1 - 5 of 19 Show all
Citations
- Koutsopoulos, O.S., Kretz, C., Weller, C.M., Roux, A., Mojzisova, H., Böhm, J., Koch, C., Toussaint, A., Heckel, E., Stemkens, D., Ter Horst, S.A., Thibault, C., Koch, M., Mehdi, S.Q., Bijlsma, E.K., Mandel, J.L., Vermot, J., and Laporte, J. (2013) Dynamin 2 homozygous mutation in humans with a lethal congenital syndrome. European journal of human genetics : EJHG. 21(6):637-42
- Li, J., Zhang, D.S., Ye, J.C., Li, C.M., Qi, M., Liang, D.D., Xu, X.R., Xu, L., Liu, Y., Zhang, H., Zhang, Y.Y., Deng, F.F., Feng, J., Shi, D., Chen, J.J., Li, L., Chen, G., Sun, Y.F., Peng, L.Y., and Chen, Y.H. (2013) Dynamin-2 mediates heart failure by modulating Ca(2+) -dependent cardiomyocyte apoptosis. International Journal of Cardiology. 168(3):2109-19
- Kida, Y.S., Sato, T., Miyasaka, K.Y., Suto, A., and Ogura, T. (2007) Daam1 regulates the endocytosis of EphB during the convergent extension of the zebrafish notochord. Proceedings of the National Academy of Sciences of the United States of America. 104(16):6708-6713
1 - 3 of 3
Show