Morpholino

MO1-dnm2a

ID
ZDB-MRPHLNO-070713-2
Name
MO1-dnm2a
Previous Names
  • MO1-dnm2
Target
Sequence
5' - ATTCCTCCATCCCCCGGTTGCCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a corrected sequence for the zDnm1 morpholino in Kida et al., 2007.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dnm2a
No data available
Phenotype
Phenotype resulting from MO1-dnm2a
Phenotype Fish Figures
cardiac muscle cell chromatin located in cardiac muscle cell nuclear membrane, abnormal WT + MO1-dnm2a Fig. 7 from Li et al., 2013
cardiac muscle cell mitochondrion vacuolated, abnormal WT + MO1-dnm2a Fig. 7 from Li et al., 2013
heart apoptotic, abnormal WT + MO1-dnm2a Fig. 7 from Li et al., 2013
heart decreased functionality, abnormal WT + MO1-dnm2a Fig. 2Fig. 7 from Li et al., 2013
heart sarcolemma edematous, abnormal WT + MO1-dnm2a Fig. 7 from Li et al., 2013
heart Z disc blurry, abnormal WT + MO1-dnm2a Fig. 7 from Li et al., 2013
heart contraction process quality, abnormal WT + MO1-dnm2a Fig. 2Fig. 7 from Li et al., 2013
intersegmental vessel increased branchiness, abnormal s843Tg + MO1-dnm2a Fig. 3 from Koutsopoulos et al., 2013
intersegmental vessel sprouting angiogenesis process quality, abnormal s843Tg + MO1-dnm2a Fig. 3 from Koutsopoulos et al., 2013
muscle cell development disrupted, abnormal AB + MO1-dnm2a Fig. 3 from Koutsopoulos et al., 2013
myocardium degenerate, abnormal WT + MO1-dnm2a Fig. 7 from Li et al., 2013
notochord bent, abnormal WT + MO1-dnm2a Fig. 3 with image from Kida et al., 2007
notochord decreased length, abnormal WT + MO1-dnm2a Fig. 3 with image from Kida et al., 2007
post-vent region bent, abnormal AB + MO1-dnm2a Fig. S5 from Koutsopoulos et al., 2013
post-vent region myofibril disorganized, abnormal AB + MO1-dnm2a Fig. 3 from Koutsopoulos et al., 2013
presumptive mesoderm decreased length, abnormal WT + MO1-dnm2a Fig. S9 with image from Kida et al., 2007
somite condensed, abnormal WT + MO1-dnm2a Fig. 3 with imageFig. S9 with image from Kida et al., 2007
whole organism dead, abnormal AB + MO1-dnm2a Fig. S5 from Koutsopoulos et al., 2013
whole organism decreased length, abnormal WT + MO1-dnm2a Fig. 3 with imageFig. S9 with image from Kida et al., 2007
Phenotype of all Fish created by or utilizing MO1-dnm2a
Phenotype Fish Conditions Figures
whole organism dead, abnormal AB + MO1-dnm2a standard conditions Fig. S5 from Koutsopoulos et al., 2013
muscle cell development disrupted, abnormal AB + MO1-dnm2a standard conditions Fig. 3 from Koutsopoulos et al., 2013
post-vent region myofibril disorganized, abnormal AB + MO1-dnm2a standard conditions Fig. 3 from Koutsopoulos et al., 2013
post-vent region bent, abnormal AB + MO1-dnm2a standard conditions Fig. S5 from Koutsopoulos et al., 2013
somite condensed, abnormal WT + MO1-dnm2a standard conditions Fig. 3 with imageFig. S9 with image from Kida et al., 2007
whole organism decreased length, abnormal WT + MO1-dnm2a standard conditions Fig. 3 with imageFig. S9 with image from Kida et al., 2007
heart Z disc blurry, abnormal WT + MO1-dnm2a standard conditions Fig. 7 from Li et al., 2013
cardiac muscle cell mitochondrion vacuolated, abnormal WT + MO1-dnm2a standard conditions Fig. 7 from Li et al., 2013
heart contraction process quality, abnormal WT + MO1-dnm2a standard conditions Fig. 2Fig. 7 from Li et al., 2013
heart apoptotic, abnormal WT + MO1-dnm2a standard conditions Fig. 7 from Li et al., 2013
notochord bent, abnormal WT + MO1-dnm2a standard conditions Fig. 3 with image from Kida et al., 2007
presumptive mesoderm decreased length, abnormal WT + MO1-dnm2a standard conditions Fig. S9 with image from Kida et al., 2007
heart sarcolemma edematous, abnormal WT + MO1-dnm2a standard conditions Fig. 7 from Li et al., 2013
myocardium degenerate, abnormal WT + MO1-dnm2a standard conditions Fig. 7 from Li et al., 2013
cardiac muscle cell chromatin located in cardiac muscle cell nuclear membrane, abnormal WT + MO1-dnm2a standard conditions Fig. 7 from Li et al., 2013
notochord decreased length, abnormal WT + MO1-dnm2a standard conditions Fig. 3 with image from Kida et al., 2007
heart decreased functionality, abnormal WT + MO1-dnm2a standard conditions Fig. 2Fig. 7 from Li et al., 2013
intersegmental vessel increased branchiness, abnormal s843Tg + MO1-dnm2a standard conditions Fig. 3 from Koutsopoulos et al., 2013
intersegmental vessel sprouting angiogenesis process quality, abnormal s843Tg + MO1-dnm2a standard conditions Fig. 3 from Koutsopoulos et al., 2013
Citations