Morpholino

MO2-aplnrb

ID
ZDB-MRPHLNO-070531-1
Name
MO2-aplnrb
Previous Names
  • MO2-agtrl1b
Target
Sequence
5' - CAGAGAAGTTGTTTGTCATGTGTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The morpholino has a 3 bp mismatch at the 3' end to agtrl1b sequences currently in the sequence databanks. The authors have verified the sequence of the morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-aplnrb
Phenotype
Phenotype resulting from MO2-aplnrb
Phenotype of all Fish created by or utilizing MO2-aplnrb
Phenotype Fish Conditions Figures
heart aplastic, abnormal WT + MO2-aplnrb standard conditions Fig. 2 from Scott et al., 2007
embryo development disrupted, abnormal WT + MO2-aplnrb standard conditions Fig. 2 from Scott et al., 2007
brain necrotic, abnormal WT + MO2-aplnrb standard conditions Fig. 2 from Scott et al., 2007
heart development disrupted, abnormal WT + MO2-aplnrb standard conditions Fig. 2 from Scott et al., 2007
eye fused with eye, abnormal WT + MO2-aplnrb + MO7-aplnra chemical treatment: SB 431542 Fig. 2 with image from Deshwar et al., 2016
endodermal cell decreased amount, abnormal WT + MO2-aplnrb + MO7-aplnra standard conditions Fig. 2 with image from Deshwar et al., 2016
endodermal cell sox32 expression decreased amount, abnormal WT + MO2-aplnrb + MO7-aplnra standard conditions Fig. 2 with image from Deshwar et al., 2016
nodal signaling pathway decreased occurrence, abnormal WT + MO2-aplnrb + MO7-aplnra standard conditions Fig. 2 with image from Deshwar et al., 2016
margin mespaa expression decreased amount, abnormal WT + MO2-aplnrb + MO7-aplnra standard conditions Fig. 4 with image from Deshwar et al., 2016
larval heart development decreased process quality, abnormal WT + MO2-aplnrb + MO7-aplnra standard conditions Fig. 3 with image from Deshwar et al., 2016
axial hypoblast noto expression decreased amount, abnormal WT + MO2-aplnrb + MO7-aplnra standard conditions Fig. 2 with image from Deshwar et al., 2016
cardiac muscle cell myl7 expression decreased amount, abnormal WT + MO2-aplnrb + MO7-aplnra standard conditions Fig. 3 with image from Deshwar et al., 2016
axial hypoblast gsc expression decreased amount, abnormal WT + MO2-aplnrb + MO7-aplnra standard conditions Fig. 2 with image from Deshwar et al., 2016
margin mespab expression decreased amount, abnormal WT + MO2-aplnrb + MO7-aplnra standard conditions Fig. 4 with image from Deshwar et al., 2016
endodermal cell sox32 expression decreased distribution, abnormal WT + MO2-aplnrb + MO7-aplnra standard conditions Fig. 2 with image from Deshwar et al., 2016
eye fused with eye, abnormal WT + MO1-tdgf1 + MO2-aplnrb + MO7-aplnra standard conditions Fig. 3 with image from Deshwar et al., 2016
larval heart development decreased process quality, abnormal WT + MO1-tdgf1 + MO2-aplnrb + MO7-aplnra standard conditions Fig. 3 with image from Deshwar et al., 2016
cardiac muscle cell myl7 expression absent, abnormal WT + MO1-tdgf1 + MO2-aplnrb + MO7-aplnra standard conditions Fig. 3 with image from Deshwar et al., 2016
Citations