Morpholino

MO2-pbx2

ID

ZDB-MRPHLNO-070529-2

Name

MO2-pbx2

Previous Names

Pbx2MO2 (1)

Target

pbx2 (1)

Sequence

5' - GCTGCAACATCCTGAGCACTACATT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-pbx2

No data available

Phenotype

Phenotype resulting from MO2-pbx2

No data available

Phenotype of all Fish created by or utilizing MO2-pbx2

Phenotype	Fish	Conditions	Figures
margin aldh1a2 expression decreased distribution, abnormal	pbx4^b557/b557 + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 8 from Selland et al., 2018
optic tectum decreased size, abnormal	pbx4^b557/b557 + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 1 from Erickson et al., 2007
cerebellum malformed, abnormal	pbx4^b557/b557 + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 1 from Erickson et al., 2007
margin aldh1a2 expression decreased amount, abnormal	pbx4^b557/b557 + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 8 from Selland et al., 2018
midbrain hindbrain boundary malformed, abnormal	pbx4^b557/b557 + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 1 from Erickson et al., 2007
cell migration to the midline involved in heart development delayed, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 4 from Maves et al., 2009
heart tube aplastic, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 4 from Maves et al., 2009
pericardium edematous, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 1 from Maves et al., 2009
heart contraction decreased rate, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 1 from Maves et al., 2009
atrium decreased size, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 4 from Maves et al., 2009
hindbrain tshz3b expression decreased amount, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	control	Fig. 5 from Erickson et al., 2011
heart morphogenesis process quality, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 4 from Maves et al., 2009
margin aldh1a2 expression decreased amount, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 8 from Selland et al., 2018
heart decreased functionality, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 1 from Maves et al., 2009
heart development disrupted, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 1 , Fig. 4 from Maves et al., 2009
cardiac ventricle shape, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 4 from Maves et al., 2009
midbrain tshz3b expression decreased amount, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	control	Fig. 5 from Erickson et al., 2011
atrium shape, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 4 from Maves et al., 2009
cardiac ventricle decreased size, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 4 from Maves et al., 2009
cardiac muscle cell differentiation disrupted, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 4 from Maves et al., 2009
heart looping disrupted, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 4 from Maves et al., 2009
heart primordium myocardial precursor decreased amount, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 4 from Maves et al., 2009
embryonic heart tube elongation disrupted, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 4 from Maves et al., 2009
heart morphology, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 1 , Fig. 5 from Maves et al., 2009
cell migration to the midline involved in heart development process quality, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 4 from Maves et al., 2009
blood accumulation atrium, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 1 from Maves et al., 2009
heart morphogenesis disrupted, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 5 from Maves et al., 2009
heart primordium unfused from heart primordium, abnormal	AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 4 from Maves et al., 2009
skeletal muscle fiber development disrupted, abnormal	WIK/AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 1 , Fig. 2 , Fig. 3 from Maves et al., 2007
heart morphology, abnormal	AB + MO1-pbx2 + MO2-hand2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 5 from Maves et al., 2009
heart primordium unfused from heart primordium, abnormal	AB + MO1-pbx2 + MO2-hand2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 5 from Maves et al., 2009
heart morphogenesis disrupted, abnormal	AB + MO1-pbx2 + MO2-hand2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4	standard conditions	Fig. 5 from Maves et al., 2009
skeletal muscle fiber development disrupted, abnormal	WIK/AB + MO1-pbx2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 + MO7-myod1 + MO8-myod1	standard conditions	Fig. 4 from Maves et al., 2007

Citations