Morpholino
MO1-mdm2
- ID
- ZDB-MRPHLNO-070516-3
- Name
- MO1-mdm2
- Previous Names
-
- mdm2 MO (1)
- Target
- Sequence
-
5' - CTCTGTTGCCATTTTGGTAGTTATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mdm2
No data available
Phenotype
Phenotype resulting from MO1-mdm2
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-mdm2
1 - 5 of 7 Show all
Citations
- Flentke, G.R., Wilkie, T.E., Baulch, J., Huang, Y., Smith, S.M. (2024) Alcohol exposure suppresses ribosome biogenesis and causes nucleolar stress in cranial neural crest cells. PLoS One. 19:e0304557e0304557
- Thomasova, D., Bruns, H.A., Kretschmer, V., Ebrahim, M., Romoli, S., Liapis, H., Kotb, A.M., Endlich, N., Anders, H.J. (2015) Murine Double Minute-2 Prevents p53-Overactivation-Related Cell Death (Podoptosis) of Podocytes. Journal of the American Society of Nephrology : JASN. 26(7):1513-23
- Tao, T., Shi, H., Guan, Y., Huang, D., Chen, Y., Lane, D.P., Chen, J., and Peng, J. (2013) Def defines a conserved nucleolar pathway that leads p53 to proteasome-independent degradation. Cell Research. 23(5):620-634
- Guo, L., Chua, J., Vijayakumar, D., Lee, K.C., Lim, K., Eng, H., Ghadessy, F., Coomber, D., and Lane, D.P. (2010) Detection of the 113p53 protein isoform: A p53-induced protein that feeds back on the p53 pathway to modulate the p53 response in zebrafish. Cell cycle (Georgetown, Tex.). 9(10):1998-2007
- Huang, C., Gu, S., Yu, P., Yu, F., Feng, C., Gao, N., and Du, J. (2010) Deficiency of smarcal1 causes cell cycle arrest and developmental abnormalities in zebrafish. Developmental Biology. 339(1):89-100
- Bretaud, S., Allen, C., Ingham, P.W., and Bandmann, O. (2007) p53-dependent neuronal cell death in a DJ-1-deficient zebrafish model of Parkinson's disease. Journal of neurochemistry. 100(6):1626-1635
- Robu, M.E., Larson, J.D., Nasevicius, A., Beiraghi, S., Brenner, C., Farber, S.A., and Ekker, S.C. (2007) p53 activation by knockdown technologies. PLoS Genetics. 3(5):e78
- Langheinrich, U., Hennen, E., Stott, G., and Vacun, G. (2002) Zebrafish as a model organism for the identification and characterization of drugs and genes affecting p53 signaling. Current biology : CB. 12(23):2023-2028
1 - 8 of 8
Show