header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070423-1
Morpholino Name: MO1-unc45b
Target: unc45b (1)
Sequence:
5' - ATCTCCAATTTCTCCCATCGTCATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-unc45b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-unc45b
Expressed Gene Anatomy Figures
myf5 Fig. S1 from Wohlgemuth et al., 2007
myh6 Fig. S2 from Wohlgemuth et al., 2007
myh7 Fig. S2 from Wohlgemuth et al., 2007
myl7 Fig. S2 from Wohlgemuth et al., 2007
myod1 Fig. S1 from Wohlgemuth et al., 2007
PHENOTYPE
Phenotype resulting from MO1-unc45b
Phenotype Figures
basibranchial mislocalised ventrally, abnormal Fig. 6 from Wohlgemuth et al., 2007
basibranchial structure, abnormal Fig. 6 from Wohlgemuth et al., 2007
basihyal bone decreased length, abnormal Fig. 6 from Wohlgemuth et al., 2007
basihyal bone mislocalised ventrally, abnormal Fig. 6 from Wohlgemuth et al., 2007
blood circulation arrested, abnormal text only from Wohlgemuth et al., 2007
cardiac ventricle non-functional, abnormal text only from Wohlgemuth et al., 2007
ceratobranchial bone mislocalised ventrally, abnormal Fig. 6 from Wohlgemuth et al., 2007
ceratobranchial bone structure, abnormal Fig. 6 from Wohlgemuth et al., 2007
ceratohyal cartilage mislocalised ventrally, abnormal Fig. 6 from Wohlgemuth et al., 2007
ceratohyal cartilage structure, abnormal Fig. 6 from Wohlgemuth et al., 2007
heart structure, abnormal Fig. 5Fig. S2 from Wohlgemuth et al., 2007
heart looping arrested, abnormal Fig. S2 from Wohlgemuth et al., 2007
Meckel's cartilage decreased length, abnormal Fig. 6 from Wohlgemuth et al., 2007
Meckel's cartilage displaced, abnormal Fig. 6 from Wohlgemuth et al., 2007
palatoquadrate cartilage decreased length, abnormal Fig. 6 from Wohlgemuth et al., 2007
palatoquadrate cartilage mislocalised, abnormal Fig. 6 from Wohlgemuth et al., 2007
pericardium edematous, abnormal Fig. 2Fig. 5 from Wohlgemuth et al., 2007
skeletal muscle cell sarcomere structure, abnormal Fig. 3 from Wohlgemuth et al., 2007
trunk musculature structure, abnormal Fig. 3Fig. 4 from Wohlgemuth et al., 2007
whole organism paralysed, abnormal text only from Wohlgemuth et al., 2007
yolk edematous, abnormal Fig. 5 from Wohlgemuth et al., 2007

Phenotype of all Fish created by or utilizing MO1-unc45b
Phenotype Fish Conditions Figures
heart looping arrested, abnormal AB + MO1-unc45b standard conditions Fig. S2 from Wohlgemuth et al., 2007
ceratobranchial bone mislocalised ventrally, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
trunk musculature structure, abnormal AB + MO1-unc45b standard conditions Fig. 3Fig. 4 from Wohlgemuth et al., 2007
whole organism paralysed, abnormal AB + MO1-unc45b standard conditions text only from Wohlgemuth et al., 2007
palatoquadrate cartilage decreased length, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
ceratobranchial bone structure, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
ceratohyal cartilage mislocalised ventrally, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
skeletal muscle cell sarcomere structure, abnormal AB + MO1-unc45b standard conditions Fig. 3 from Wohlgemuth et al., 2007
yolk edematous, abnormal AB + MO1-unc45b standard conditions Fig. 5 from Wohlgemuth et al., 2007
Meckel's cartilage decreased length, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
basibranchial mislocalised ventrally, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
heart structure, abnormal AB + MO1-unc45b standard conditions Fig. 5Fig. S2 from Wohlgemuth et al., 2007
Meckel's cartilage displaced, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
basihyal bone mislocalised ventrally, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
blood circulation arrested, abnormal AB + MO1-unc45b standard conditions text only from Wohlgemuth et al., 2007
ceratohyal cartilage structure, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
pericardium edematous, abnormal AB + MO1-unc45b standard conditions Fig. 2Fig. 5 from Wohlgemuth et al., 2007
basihyal bone decreased length, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
basibranchial structure, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
cardiac ventricle non-functional, abnormal AB + MO1-unc45b standard conditions text only from Wohlgemuth et al., 2007
palatoquadrate cartilage mislocalised, abnormal AB + MO1-unc45b standard conditions Fig. 6 from Wohlgemuth et al., 2007
OTHER MO1-unc45b MORPHOLINO PAGESNo links to external sites
CITATIONS (7)