Morpholino
MO3-sox9a
- ID
- ZDB-MRPHLNO-070412-2
- Name
- MO3-sox9a
- Previous Names
- Target
- Sequence
-
5' - CGAGTCAAGTTTAGTGTCCCACCTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sox9a
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| nr5a2 |
|
Fig. 3
from Koskinen et al., 2009 |
1 - 1 of 1
Phenotype
Phenotype resulting from MO3-sox9a
No data available
Phenotype of all Fish created by or utilizing MO3-sox9a
from 1 - 5 of 25 Show all
Citations
- Chen, J.W., Galloway, J.L. (2014) The development of zebrafish tendon and ligament progenitors. Development (Cambridge, England). 141:2035-45
- Le Pabic, P., Ng, C., Schilling, T.F. (2014) Fat-Dachsous Signaling Coordinates Cartilage Differentiation and Polarity during Craniofacial Development. PLoS Genetics. 10:e1004726
- Koskinen, J., Karlsson, J., and Olsson, P.E. (2009) Sox9a regulation of ff1a in zebrafish (Danio rerio) suggests an involvement of ff1a in cartilage development. Comparative biochemistry and physiology. Part A, Molecular & integrative physiology. 153(1):39-43
- Yan, Y.-L., Miller, C.T., Nissen, R.M., Singer, A., Liu, D., Kirn, A., Draper, B., Willoughby, J., Morcos, P.A., Amsterdam, A., Chung, B.-C., Westerfield, M., Haffter, P., Hopkins, N., Kimmel, C., and Postlethwait, J.H. (2002) A zebrafish sox9 gene required for cartilage morphogenesis. Development (Cambridge, England). 129(21):5065-5079
1 - 4 of 4
Show