Morpholino

MO1-cav1

ID
ZDB-MRPHLNO-070321-1
Name
MO1-cav1
Previous Names
None
Target
Sequence
5' - TCCCGTCCTTGTATCCGCTAGTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the cav1 alpha splice variant at the start site.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cav1
No data available
Phenotype
Phenotype resulting from MO1-cav1
Phenotype Fish Figures
brain structure, abnormal WT + MO1-cav1 Fig. 4 from Fang et al., 2006
cranial vasculature spatial pattern, abnormal y1Tg + MO1-cav1 Fig. 9 from Fang et al., 2006
epidermis actin cytoskeleton disorganized, abnormal WT + MO1-cav1 Fig. 8 from Fang et al., 2006
epidermis cell size, abnormal WT + MO1-cav1 Fig. 8 from Fang et al., 2006
eye morphology, abnormal WT + MO1-cav1 Fig. 4 from Fang et al., 2006
heart increased size, abnormal WT + MO1-cav1 Fig. 4 from Fang et al., 2006
melanocyte pigment granule movement quality, abnormal WT + MO1-cav1 text only from Fang et al., 2006
midbrain hindbrain boundary aplastic, abnormal WT + MO1-cav1 Fig. 4 from Fang et al., 2006
nervous system vacuolated, abnormal WT + MO1-cav1 Fig. 4 from Fang et al., 2006
notochord malformed, abnormal WT + MO1-cav1 Fig. 4 from Nixon et al., 2007
notochord undulate, abnormal WT + MO1-cav1 Fig. 4 from Nixon et al., 2007
post-vent region bent, abnormal WT + MO1-cav1 Fig. 4 from Fang et al., 2006
post-vent region curved ventral, abnormal WT + MO1-cav1 Fig. 4 from Nixon et al., 2007
post-vent region decreased length, abnormal WT + MO1-cav1 Fig. 4 from Fang et al., 2006
post-vent vasculature spatial pattern, abnormal y1Tg + MO1-cav1 Fig. 9 from Fang et al., 2006
posterior lateral line neuromast decreased amount, abnormal WT + MO1-cav1 Fig. 4 from Nixon et al., 2007
retinal pigmented epithelium disorganized, abnormal WT + MO1-cav1 Fig. 4 from Fang et al., 2006
retinal pigmented epithelium morphology, abnormal WT + MO1-cav1 text only from Nixon et al., 2007
retinal pigmented epithelium pigment granule movement quality, abnormal WT + MO1-cav1 text only from Fang et al., 2006
somite disorganized, abnormal WT + MO1-cav1 text only from Nixon et al., 2007
Fig. 4 from Fang et al., 2006
somite myofibril absent, abnormal WT + MO1-cav1 Fig. 8 from Fang et al., 2006
trunk curved, abnormal WT + MO1-cav1 Fig. 4 from Fang et al., 2006
whole organism curved ventral, abnormal WT + MO1-cav1 Fig. 4 from Nixon et al., 2007
whole organism ab1-nme2 labeling decreased amount, abnormal WT + MO1-cav1 Fig. 2 from Hippe et al., 2011
whole organism ab1-gnb labeling decreased amount, abnormal WT + MO1-cav1 Fig. 2 from Hippe et al., 2011
whole organism morphology, abnormal WT + MO1-cav1 Fig. 2 from Hippe et al., 2011
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-cav1 Fig. 4 from Fang et al., 2006
Phenotype of all Fish created by or utilizing MO1-cav1
Phenotype Fish Conditions Figures
whole organism curved ventral, abnormal WT + MO1-cav1 standard conditions Fig. 4 from Nixon et al., 2007
epidermis cell size, abnormal WT + MO1-cav1 standard conditions Fig. 8 from Fang et al., 2006
notochord undulate, abnormal WT + MO1-cav1 standard conditions Fig. 4 from Nixon et al., 2007
epidermis actin cytoskeleton disorganized, abnormal WT + MO1-cav1 standard conditions Fig. 8 from Fang et al., 2006
post-vent region bent, abnormal WT + MO1-cav1 standard conditions Fig. 4 from Fang et al., 2006
post-vent region decreased length, abnormal WT + MO1-cav1 standard conditions Fig. 4 from Fang et al., 2006
retinal pigmented epithelium disorganized, abnormal WT + MO1-cav1 standard conditions Fig. 4 from Fang et al., 2006
somite disorganized, abnormal WT + MO1-cav1 standard conditions text only from Nixon et al., 2007
Fig. 4 from Fang et al., 2006
trunk curved, abnormal WT + MO1-cav1 standard conditions Fig. 4 from Fang et al., 2006
somite myofibril absent, abnormal WT + MO1-cav1 standard conditions Fig. 8 from Fang et al., 2006
retinal pigmented epithelium morphology, abnormal WT + MO1-cav1 standard conditions text only from Nixon et al., 2007
retinal pigmented epithelium pigment granule movement quality, abnormal WT + MO1-cav1 standard conditions text only from Fang et al., 2006
brain structure, abnormal WT + MO1-cav1 standard conditions Fig. 4 from Fang et al., 2006
melanocyte pigment granule movement quality, abnormal WT + MO1-cav1 standard conditions text only from Fang et al., 2006
post-vent region curved ventral, abnormal WT + MO1-cav1 standard conditions Fig. 4 from Nixon et al., 2007
whole organism ab1-nme2 labeling decreased amount, abnormal WT + MO1-cav1 control Fig. 2 from Hippe et al., 2011
heart increased size, abnormal WT + MO1-cav1 standard conditions Fig. 4 from Fang et al., 2006
whole organism ab1-gnb labeling decreased amount, abnormal WT + MO1-cav1 control Fig. 2 from Hippe et al., 2011
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-cav1 standard conditions Fig. 4 from Fang et al., 2006
nervous system vacuolated, abnormal WT + MO1-cav1 standard conditions Fig. 4 from Fang et al., 2006
eye morphology, abnormal WT + MO1-cav1 standard conditions Fig. 4 from Fang et al., 2006
midbrain hindbrain boundary aplastic, abnormal WT + MO1-cav1 standard conditions Fig. 4 from Fang et al., 2006
notochord malformed, abnormal WT + MO1-cav1 standard conditions Fig. 4 from Nixon et al., 2007
posterior lateral line neuromast decreased amount, abnormal WT + MO1-cav1 standard conditions Fig. 4 from Nixon et al., 2007
whole organism morphology, abnormal WT + MO1-cav1 control Fig. 2 from Hippe et al., 2011
somite caveola absent, abnormal WT + MO1-cav1 + MO2-cav1 standard conditions text only from Fang et al., 2006
nervous system caveola absent, abnormal WT + MO1-cav1 + MO2-cav1 standard conditions text only from Fang et al., 2006
notochord caveola decreased amount, abnormal WT + MO1-cav1 + MO2-cav1 standard conditions Fig. 7 from Fang et al., 2006
muscle cell myofibril disorganized, abnormal WT + MO1-cav1 + MO2-cav1 standard conditions Fig. 7 from Fang et al., 2006
muscle cell sarcoplasmic reticulum disorganized, abnormal WT + MO1-cav1 + MO2-cav1 standard conditions Fig. 7 from Fang et al., 2006
cranial vasculature spatial pattern, abnormal y1Tg + MO1-cav1 standard conditions Fig. 9 from Fang et al., 2006
post-vent vasculature spatial pattern, abnormal y1Tg + MO1-cav1 standard conditions Fig. 9 from Fang et al., 2006
Citations