header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070315-4
Morpholino Name: MO1-wnt2ba
Target: wnt2ba (1)
Previous Names: MO1-wnt2b, wnt2b MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACCCAACTCCATCACACTCTGGCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-wnt2ba No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-wnt2ba
Expressed Gene Anatomy Figures
fibinb Fig. 5 with image from Wakahara et al., 2007
PHENOTYPE
Phenotype resulting from MO1-wnt2ba
Phenotype of all Fish created by or utilizing MO1-wnt2ba
Genome Resources:
CITATIONS (1)