Morpholino
MO1-wnt2ba
- ID
- ZDB-MRPHLNO-070315-4
- Name
- MO1-wnt2ba
- Previous Names
-
- MO1-wnt2b
- wnt2b MO (1)
- Target
- Sequence
-
5' - ACCCAACTCCATCACACTCTGGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt2ba
No data available
Phenotype
Phenotype resulting from MO1-wnt2ba
Phenotype | Fish | Figures |
---|---|---|
pectoral fin field morphology, abnormal | WT + MO1-wnt2ba |
Fig. 5 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-wnt2ba
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
pectoral fin field morphology, abnormal | WT + MO1-wnt2ba | standard conditions |
Fig. 5 ![]() |
1 - 1 of 1
Citations
- Drummond, B.E., Chambers, B.E., Wesselman, H.M., Gibson, S., Arceri, L., Ulrich, M.N., Gerlach, G.F., Kroeger, P.T., Leshchiner, I., Goessling, W., Wingert, R.A. (2022) osr1 Maintains Renal Progenitors and Regulates Podocyte Development by Promoting wnt2ba via the Antagonism of hand2. Biomedicines. 10(11):
- Wakahara, T., Kusu, N., Yamauchi, H., Kimura, I., Konishi, M., Miyake, A., and Itoh, N. (2007) fibin, a novel secreted lateral plate mesoderm signal, is essential for pectoral fin bud initiation in zebrafish. Developmental Biology. 303(2):527-535
1 - 2 of 2
Show