Morpholino
MO6-pkd2
- ID
- ZDB-MRPHLNO-070129-3
- Name
- MO6-pkd2
- Previous Names
-
- pkd2 MOex5
- Target
- Sequence
-
5' - GATCAACCCGTTACCTGACAATACA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
splice-blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-pkd2
No data available
Phenotype
Phenotype resulting from MO6-pkd2
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO6-pkd2
1 - 5 of 13 Show all
Citations
- Hofherr, A., Seger, C., Fitzpatrick, F., Busch, T., Michel, E., Luan, J., Osterried, L., Linden, F., Kramer-Zucker, A., Wakimoto, B., Schütze, C., Wiedemann, N., Artati, A., Adamski, J., Walz, G., Kunji, E.R.S., Montell, C., Watnick, T., Köttgen, M. (2018) The mitochondrial transporter SLC25A25 links ciliary TRPP2 signaling and cellular metabolism. PLoS Biology. 16:e2005651
- Fu, X., Wang, Y., Schetle, N., Gao, H., Pütz, M., von Gersdorff, G., Walz, G., and Kramer-Zucker, A.G. (2008) The Subcellular Localization of TRPP2 Modulates Its Function. Journal of the American Society of Nephrology : JASN. 19(7):1342-1351
- Obara, T., Mangos, S., Liu, Y., Zhao, J., Wiessner, S., Kramer-Zucker, A.G., Olale, F., Schier, A.F., and Drummond, I.A. (2006) Polycystin-2 Immunolocalization and Function in Zebrafish. Journal of the American Society of Nephrology : JASN. 17(10):2706-2718
1 - 3 of 3
Show