Morpholino

MO1-foxc1a

ID
ZDB-MRPHLNO-061111-1
Name
MO1-foxc1a
Previous Names
None
Target
Sequence
5' - GTCAAGAAGACTGAAGCAATCCACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-foxc1a
Phenotype
Phenotype resulting from MO1-foxc1a
Phenotype of all Fish created by or utilizing MO1-foxc1a
Phenotype Fish Conditions Figures
pronephric podocyte decreased amount, abnormal TU + MO1-foxc1a standard conditions Fig. 3 with image from O'Brien et al., 2011
optic fissure closure incomplete, abnormal WT + MO1-foxc1a + MO2-foxc1a standard conditions Fig. 6 with image from Lupo et al., 2011
closure of optic fissure arrested, abnormal WT + MO1-foxc1a + MO2-foxc1a standard conditions Fig. 6 with image from Lupo et al., 2011
endocardium decreased size, abnormal WT + MO1-foxc1a + MO13-tp53 + MO3-foxc1a standard conditions Fig. S5 with image from Palencia-Desai et al., 2011
endocardium morphology, abnormal WT + MO1-foxc1a + MO13-tp53 + MO3-foxc1a standard conditions Fig. S5 with image from Palencia-Desai et al., 2011
endocardium morphology, abnormal s843Tg + MO1-foxc1a + MO13-tp53 + MO3-foxc1a standard conditions Fig. S5 with image from Palencia-Desai et al., 2011
endocardium decreased size, abnormal s843Tg + MO1-foxc1a + MO13-tp53 + MO3-foxc1a standard conditions Fig. S5 with image from Palencia-Desai et al., 2011
pronephric podocyte decreased amount, abnormal TU + MO1-foxc1a + MO3-wt1a standard conditions Fig. 3 with image from O'Brien et al., 2011
interrenal primordium absent, abnormal TU + MO1-foxc1a + MO3-wt1a standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric tubule absent, abnormal TU + MO1-foxc1a + MO3-wt1a standard conditions Fig. 3 with image from O'Brien et al., 2011
interrenal primordium increased size, abnormal TU + MO1-foxc1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric podocyte decreased amount, abnormal TU + MO1-foxc1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
pronephric tubule morphology, abnormal TU + MO1-foxc1a + MO4-rbpja,rbpjb standard conditions Fig. 3 with image from O'Brien et al., 2011
Citations