Morpholino

MO1-has2

ID
ZDB-MRPHLNO-060930-5
Name
MO1-has2
Previous Names
None
Target
Sequence
5' - AGCAGCTCTTTGGAGATGTCCCGTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-has2
Expressed Gene Anatomy Figures
alcama Fig. S7 from Lagendijk et al., 2011
Fig. 6 with image from Patra et al., 2011
ctslb Fig. 3 with image from von der Hardt et al., 2007
dlx3b Fig. S8 from Tawk et al., 2007
gata1a Fig. S2 with image from von der Hardt et al., 2007
lft2 Fig. 2 with image from Veerkamp et al., 2013
myod1 Fig. 3 with image from von der Hardt et al., 2007
pax2a Fig. 3 with image from von der Hardt et al., 2007
pcdh8 Fig. S8 from Tawk et al., 2007
szl Fig. S2 with image from von der Hardt et al., 2007
Phenotype
Phenotype resulting from MO1-has2
Phenotype Fish Figures
atrioventricular canal increased width, abnormal f1Tg + MO1-has2 Fig. 4 from Tong et al., 2014
atrioventricular canal endocardium decreased length, abnormal s843Tg + MO1-has2 Fig. 6 with image from Patra et al., 2011
atrioventricular canal endocardium endothelial cell scaly, abnormal la116Tg + MO1-has2 Fig. S7 from Lagendijk et al., 2011
atrioventricular valve formation decreased process quality, abnormal la116Tg + MO1-has2 Fig. S7 from Lagendijk et al., 2011
cardiac jelly decreased volume, abnormal WT + MO1-has2 Fig. 5 with image from Patra et al., 2011
cell migration in hindbrain disrupted, abnormal WT + MO1-has2 Fig. S8 from Tawk et al., 2007
dorsal convergence disrupted, abnormal WT + MO1-has2 Fig. 4 with image from von der Hardt et al., 2007
endocardial cell differentiation decreased process quality, abnormal la116Tg + MO1-has2 Fig. S7 from Lagendijk et al., 2011
heart jogging decreased process quality, abnormal twu34Tg + MO1-has2 Fig. 2 with image from Veerkamp et al., 2013
heart rudiment bilateral symmetry, abnormal twu34Tg + MO1-has2 Fig. 2 with image from Veerkamp et al., 2013
heart rudiment mislocalised, abnormal twu34Tg + MO1-has2 Fig. 2 with image from Veerkamp et al., 2013
neural keel increased width, abnormal WT + MO1-has2 Fig. S8 from Tawk et al., 2007
neural tube epithelium duplicated, abnormal WT + MO1-has2 Fig. 4,  Fig. S8 from Tawk et al., 2007
Phenotype of all Fish created by or utilizing MO1-has2
Phenotype Fish Conditions Figures
neural tube epithelium duplicated, abnormal WT + MO1-has2 standard conditions Fig. 4,  Fig. S8 from Tawk et al., 2007
neural keel increased width, abnormal WT + MO1-has2 standard conditions Fig. S8 from Tawk et al., 2007
cardiac jelly decreased volume, abnormal WT + MO1-has2 standard conditions Fig. 5 with image from Patra et al., 2011
dorsal convergence disrupted, abnormal WT + MO1-has2 standard conditions Fig. 4 with image from von der Hardt et al., 2007
cell migration in hindbrain disrupted, abnormal WT + MO1-has2 standard conditions Fig. S8 from Tawk et al., 2007
heart looping disrupted, abnormal WT + MO1-has2 + MO2-has2 standard conditions Fig. 3 with image from Smith et al., 2008
determination of left/right symmetry disrupted, abnormal WT + MO1-has2 + MO2-has2 standard conditions Fig. 3 with image from Smith et al., 2008
atrioventricular canal increased width, abnormal f1Tg + MO1-has2 standard conditions Fig. 4 from Tong et al., 2014
endocardial cell differentiation decreased process quality, abnormal la116Tg + MO1-has2 standard conditions Fig. S7 from Lagendijk et al., 2011
atrioventricular valve formation decreased process quality, abnormal la116Tg + MO1-has2 standard conditions Fig. S7 from Lagendijk et al., 2011
atrioventricular canal endocardium endothelial cell scaly, abnormal la116Tg + MO1-has2 standard conditions Fig. S7 from Lagendijk et al., 2011
atrioventricular canal endocardium decreased length, abnormal s843Tg + MO1-has2 standard conditions Fig. 6 with image from Patra et al., 2011
heart rudiment mislocalised, abnormal twu34Tg + MO1-has2 standard conditions Fig. 2 with image from Veerkamp et al., 2013
heart rudiment bilateral symmetry, abnormal twu34Tg + MO1-has2 standard conditions Fig. 2 with image from Veerkamp et al., 2013
heart jogging decreased process quality, abnormal twu34Tg + MO1-has2 standard conditions Fig. 2 with image from Veerkamp et al., 2013
heart looping disrupted, abnormal twu34Tg + MO1-has2 + MO2-has2 standard conditions Fig. 3 with image from Smith et al., 2008
determination of left/right symmetry disrupted, abnormal twu34Tg + MO1-has2 + MO2-has2 standard conditions Fig. 3 with image from Smith et al., 2008
heart rudiment rotated, abnormal twu34Tg + MO1-has2 + MO2-has2 standard conditions Fig. 3 with image from Smith et al., 2008
somite malformed, abnormal bmp2bta72a/+ + MO1-has2 standard conditions Fig. 3 with image from von der Hardt et al., 2007
dorsal convergence disrupted, abnormal bmp2bta72a/+ + MO1-has2 standard conditions Fig. 3 with image from von der Hardt et al., 2007
lateral mesoderm mislocalised, abnormal bmp2bta72a/+ + MO1-has2 standard conditions Fig. 3 with image from von der Hardt et al., 2007
notochord undulate, abnormal bmp2bta72a/+ + MO1-has2 standard conditions Fig. 3 with image from von der Hardt et al., 2007
neurocranium posterior region hypoplastic, abnormal fgf8ati282a/ti282a + MO1-has2 + MO2-has2 standard conditions Fig. 7 with image from McCarthy et al., 2016
neurocranium posterior region absent, abnormal fgf8ati282a/ti282a + MO1-has2 + MO2-has2 standard conditions Fig. 7 with image from McCarthy et al., 2016
neurocranium posterior region morphology, abnormal fgf8ati282a/ti282a + MO1-has2 + MO2-has2 standard conditions Fig. 7 with image from McCarthy et al., 2016
heart looping disrupted, abnormal WT + MO1-bmp4 + MO1-has2 + MO2-has2 + MO3-bmp4 standard conditions Fig. S2 with image from Smith et al., 2008
pericardium edematous, abnormal WT + MO1-bmp4 + MO1-has2 + MO2-has2 + MO3-bmp4 standard conditions Fig. S2 with image from Smith et al., 2008
caudal fin decreased size, abnormal WT + MO1-bmp4 + MO1-has2 + MO2-has2 + MO3-bmp4 standard conditions Fig. S2 with image from Smith et al., 2008
cardiac jelly decreased volume, abnormal WT + MO1-has2 + MO2-npnta standard conditions Fig. 5 with image from Patra et al., 2011
atrioventricular canal endocardium decreased length, abnormal s843Tg + MO1-has2 + MO2-npnta standard conditions Fig. 6 with image from Patra et al., 2011
atrioventricular valve formation decreased process quality, abnormal la116Tg + MO1-has2 + MO1-mir23a standard conditions Fig. 7 from Lagendijk et al., 2011
endocardial cushion poorly differentiated, abnormal la116Tg + MO1-has2 + MO1-mir23a standard conditions Fig. 7 from Lagendijk et al., 2011
atrioventricular valve formation decreased process quality, abnormal dicer1hu896/hu896; la116Tg + MO1-has2 chemical treatment: pharmaceutical Fig. 7 from Lagendijk et al., 2011
endocardial cushion poorly differentiated, abnormal dicer1hu896/hu896; la116Tg + MO1-has2 chemical treatment: pharmaceutical Fig. 7 from Lagendijk et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.