Morpholino

MO2-irx7

ID

ZDB-MRPHLNO-060918-1

Name

MO2-irx7

Previous Names

None

Target

Sequence

5' - GGCATCCTTACTCCCTGAGCTCTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-irx7

Expressed Gene	Anatomy	Figures
egr2b	neural plate presumptive rhombomere 3 presumptive rhombomere 4 presumptive rhombomere 5 rhombomere 3 rhombomere 5	Fig. 1 from Stedman et al., 2009 Fig. 2 , Fig. 3 , Fig. 7 from Lecaudey et al., 2004
fgf3	neural plate presumptive rhombomere 4	Fig. 2 from Lecaudey et al., 2004
fgf8a	presumptive brain	Fig. 2 from Lecaudey et al., 2004
hnf1ba	neural plate	Fig. 4 from Lecaudey et al., 2004
hoxa2b	presumptive rhombomere 2 presumptive rhombomere 3	Fig. 2 from Lecaudey et al., 2004
hoxb1a	neural plate presumptive rhombomere 4	Fig. 3 from Lecaudey et al., 2004
irx7	head neural plate (not) whole organism	Fig. 4 from Zhang et al., 2012 Fig. S4 from Stedman et al., 2009 Fig. 4 from Lecaudey et al., 2004
mafba	(not) Mauthner neuron presumptive rhombomere 4 presumptive rhombomere 5 presumptive rhombomere 6 rhombomere 5 rhombomere 6	Fig. 3 , Fig. 7 from Lecaudey et al., 2004
neurog1	hindbrain neural keel hindbrain neural plate trigeminal placode	Fig. 7 from Lecaudey et al., 2004
pax2a	midbrain hindbrain boundary neural rod otic placode	Fig. 2 from Lecaudey et al., 2004
wnt1	epiphysis midbrain hindbrain boundary neural rod neural rod	Fig. 2 from Lecaudey et al., 2004

Phenotype

Phenotype resulting from MO2-irx7

Phenotype	Fish	Figures
eye decreased size, abnormal	AB + MO2-irx7	Fig. 3 from Zhang et al., 2012
retinal rod cell decreased amount, abnormal	AB + MO2-irx7	Fig. 10 from Zhang et al., 2012
whole organism morphology, abnormal	AB + MO2-irx7	Fig. 3 from Zhang et al., 2012

Phenotype of all Fish created by or utilizing MO2-irx7

Phenotype	Fish	Conditions	Figures
eye decreased size, abnormal	AB + MO2-irx7	standard conditions	Fig. 3 from Zhang et al., 2012
retinal rod cell decreased amount, abnormal	AB + MO2-irx7	standard conditions	Fig. 10 from Zhang et al., 2012
whole organism morphology, abnormal	AB + MO2-irx7	standard conditions	Fig. 3 from Zhang et al., 2012
hindbrain development disrupted, abnormal	WT + MO2-irx1b + MO2-irx7	standard conditions	Fig. 1 , Fig. 2 from Stedman et al., 2009
cranial nerve V motor neuron absent, abnormal	rw0Tg + MO2-irx1b + MO2-irx7	standard conditions	Fig. 2 from Stedman et al., 2009
cranial nerve VII motor neuron decreased amount, abnormal	rw0Tg + MO2-irx1b + MO2-irx7	standard conditions	Fig. 2 from Stedman et al., 2009

Citations