ZFIN ID: ZDB-MRPHLNO-060916-1
Morpholino Name: MO1-lamb1a
Target: lamb1a (1)
Previous Name: MO1-lamb1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TATTTCCAGTTTCTTTCTTCAGCGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-lamb1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-lamb1a No data available
PHENOTYPE
Phenotype resulting from MO1-lamb1a
Phenotype of all Fish created by or utilizing MO1-lamb1a
Phenotype Fish Conditions Figures
myotome U-shaped, abnormal WT + MO1-lamb1a standard conditions Fig. 3 with image from Goody et al., 2010
muscle cell migration disrupted, abnormal WT + MO1-lamb1a standard conditions Fig. S1 with image from Snow et al., 2008
muscle tissue development disrupted, abnormal WT + MO1-lamb1a standard conditions Fig. 3 with image from Goody et al., 2010
myotome shape, abnormal WT + MO1-lamb1a standard conditions Fig. S1 with image from Snow et al., 2008
fast muscle cell myosin filament disorganized, abnormal WT + MO1-lamb1a standard conditions Fig. S1 with image from Snow et al., 2008
myotome decreased thickness, abnormal WT + MO1-lamb1a standard conditions Fig. 3 with image from Goody et al., 2010
muscle tissue development disrupted, abnormal WT + MO1-lamb1a chemical treatment: NAD(+) Fig. 3 with image from Goody et al., 2010
skeletal muscle fiber development disrupted, abnormal WT + MO1-lamb1a standard conditions Fig. S1 with image from Snow et al., 2008
notochord undifferentiated, abnormal WT + MO1-lamb1a standard conditions Fig. 3 with image from Parsons et al., 2002
myotome U-shaped, abnormal WT + MO1-lamb1a chemical treatment: NAD(+) Fig. 3 with image from Goody et al., 2010
slow muscle cell myosin filament disorganized, abnormal WT + MO1-lamb1a standard conditions Fig. S1 with image from Snow et al., 2008
whole organism decreased length, abnormal WT + MO1-lamb1a standard conditions Fig. 3 with image from Parsons et al., 2002
notochord formation disrupted, abnormal WT + MO1-lamb1a standard conditions Fig. 3 with image from Parsons et al., 2002
myotome decreased thickness, abnormal WT + MO1-lamb1a chemical treatment: NAD(+) Fig. 3 with image from Goody et al., 2010
endoderm increased width, abnormal ha01Tg + MO1-lamb1a + MO4-tp53 standard conditions Fig. S6 with image from Hu et al., 2018
endoderm increased width, abnormal ha01Tg + MO1-fn1a + MO1-lamb1a + MO4-tp53 standard conditions Fig. 6 with imageFig. S6 with image from Hu et al., 2018
endoderm increased width, ameliorated gpc4fr6/fr6 ; ha01Tg + MO1-fn1a + MO1-lamb1a + MO4-tp53 standard conditions Fig. 6 with image from Hu et al., 2018
Genome Resources:
CITATIONS (4)