Morpholino
MO1-wnt2bb
- ID
- ZDB-MRPHLNO-060824-3
- Name
- MO1-wnt2bb
- Previous Names
- None
- Target
- Sequence
-
5' - GTGTGCCATATAAAAGTATTCCCCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt2bb
Expressed Gene | Anatomy | Figures |
---|---|---|
cp |
Fig. 2 ![]() |
|
epcam |
Fig. 3 ![]() |
|
hhex |
Fig. 2 ![]() |
|
nav3 |
Fig. 5 ![]() |
1 - 4 of 4
Phenotype
Phenotype resulting from MO1-wnt2bb
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-wnt2bb
1 - 5 of 9 Show all
Citations
- Lu, H., Ma, J., Yang, Y., Shi, W., and Luo, L. (2013) EpCAM Is an Endoderm-Specific Wnt Derepressor that Licenses Hepatic Development. Developmental Cell. 24(5):543-553
- Gore, A.V., Swift, M.R., Cha, Y.R., Lo, B., McKinney, M.C., Li, W., Castranova, D., Davis, A., Mukouyama, Y.S., and Weinstein, B.M. (2011) Rspo1/Wnt signaling promotes angiogenesis via Vegfc/Vegfr3. Development (Cambridge, England). 138(22):4875-4886
- Klein, C., Mikutta, J., Krueger, J., Scholz, K., Brinkmann, J., Liu, D., Veerkamp, J., Siegel, D., Abdelilah-Seyfried, S., and le Noble, F. (2011) Neuron navigator 3a regulates liver organogenesis during zebrafish embryogenesis. Development (Cambridge, England). 138(10):1935-1945
- Ober, E.A., Verkade, H., Field, H.A., and Stainier, D.Y. (2006) Mesodermal Wnt2b signalling positively regulates liver specification. Nature. 442(7103):688-691
1 - 4 of 4
Show