ZFIN ID: ZDB-MRPHLNO-060824-3
Morpholino Name: MO1-wnt2bb
Target: wnt2bb (1)
Sequence:
5' - GTGTGCCATATAAAAGTATTCCCCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-wnt2bb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-wnt2bb
Expressed Gene Anatomy Figures
cp Fig. 2 with image from Lu et al., 2013
epcam Fig. 3 with image from Lu et al., 2013
hhex Fig. 2 with image from Lu et al., 2013
nav3 Fig. 5 with image from Klein et al., 2011
PHENOTYPE
Phenotype resulting from MO1-wnt2bb
Phenotype Figures
angiogenesis disrupted, abnormal Fig. 3 with image from Gore et al., 2011
intersegmental vessel decreased length, abnormal Fig. 3 with image from Gore et al., 2011
liver aplastic, abnormal Fig. 5 with image from Klein et al., 2011
Fig. 3 from Ober et al., 2006
liver decreased size, abnormal Fig. 2 with imageFig. 7 with image from Lu et al., 2013
liver development arrested, abnormal Fig. 3 from Ober et al., 2006
liver development disrupted, abnormal Fig. 5 with image from Klein et al., 2011

Phenotype of all Fish created by or utilizing MO1-wnt2bb
Phenotype Fish Conditions Figures
intersegmental vessel decreased length, abnormal y1Tg/y1Tg + MO1-wnt2bb standard conditions Fig. 3 with image from Gore et al., 2011
angiogenesis disrupted, abnormal y1Tg/y1Tg + MO1-wnt2bb standard conditions Fig. 3 with image from Gore et al., 2011
liver decreased size, abnormal as3Tg + MO1-wnt2bb standard conditions Fig. 2 with imageFig. 7 with image from Lu et al., 2013
liver aplastic, abnormal s854Tg + MO1-wnt2bb standard conditions Fig. 3 from Ober et al., 2006
liver development arrested, abnormal s854Tg + MO1-wnt2bb standard conditions Fig. 3 from Ober et al., 2006
liver aplastic, abnormal s870Tg + MO1-wnt2bb standard conditions Fig. 5 with image from Klein et al., 2011
liver development disrupted, abnormal s870Tg + MO1-wnt2bb standard conditions Fig. 5 with image from Klein et al., 2011
intersegmental vessel absent, abnormal y1Tg/y1Tg + MO1-wnt2bb + MO3-rspo1 standard conditions Fig. 3 with image from Gore et al., 2011
angiogenesis disrupted, abnormal y1Tg/y1Tg + MO1-wnt2bb + MO3-rspo1 standard conditions Fig. 3 with image from Gore et al., 2011
OTHER MO1-wnt2bb MORPHOLINO PAGESNo links to external sites
CITATIONS (4)