header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060824-3
Morpholino Name: MO1-wnt2bb
Target: wnt2bb (1)
Sequence:
5' - GTGTGCCATATAAAAGTATTCCCCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-wnt2bb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-wnt2bb
Expressed Gene Anatomy Figures
cp Fig. 2 with image from Lu et al., 2013
epcam Fig. 3 with image from Lu et al., 2013
hhex Fig. 2 with image from Lu et al., 2013
nav3 Fig. 5 with image from Klein et al., 2011
PHENOTYPE
Phenotype resulting from MO1-wnt2bb
Phenotype of all Fish created by or utilizing MO1-wnt2bb
Genome Resources:
CITATIONS (4)