Morpholino

MO1-dlx5a

ID
ZDB-MRPHLNO-060822-7
Name
MO1-dlx5a
Previous Names
None
Target
Sequence
5' - CGAATACTCCAGTCATAGTTTGGAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocker.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dlx5a
No data available
Phenotype
Phenotype resulting from MO1-dlx5a
Phenotype of all Fish created by or utilizing MO1-dlx5a
Phenotype Fish Conditions Figures
embryonic viscerocranium morphogenesis disrupted, abnormal AB + MO1-dlx5a standard conditions Fig. 1 with image from Talbot et al., 2010
symplectic decreased length, abnormal AB + MO1-dlx5a standard conditions Fig. 1 with image from Talbot et al., 2010
regenerating fin caudal fin lepidotrichium increased length, abnormal C32 + MO1-dlx5a amputation Fig. 4 with image from Ton et al., 2013
olfactory bulb glomerulus aplastic/hypoplastic, abnormal rw037Tg + MO1-dlx5a + MO3-dlx5a standard conditions Fig. 4 from Garaffo et al., 2013
olfactory epithelium morphology, abnormal rw037Tg + MO1-dlx5a + MO3-dlx5a standard conditions Fig. 4 from Garaffo et al., 2013
olfactory nerve formation process quality, abnormal rw037Tg + MO1-dlx5a + MO3-dlx5a standard conditions Fig. 4 from Garaffo et al., 2013
cranial nerve I axon mislocalised, abnormal rw037Tg + MO1-dlx5a + MO3-dlx5a standard conditions Fig. 4 from Garaffo et al., 2013
interhyal-epihyal joint absent, abnormal WT + MO1-dlx3b + MO1-dlx5a standard conditions Fig. 3 with image from Walker et al., 2006
mandibular arch skeleton joint absent, abnormal WT + MO1-dlx3b + MO1-dlx5a standard conditions Fig. 3 with image from Walker et al., 2006
opercle fused with branchiostegal ray, abnormal AB + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b standard conditions Fig. 1 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal AB + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b standard conditions Fig. 1 with image from Talbot et al., 2010
palatoquadrate cartilage morphology, abnormal AB + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b standard conditions Fig. 1 with image from Talbot et al., 2010
palatoquadrate cartilage morphology, abnormal Df(Chr01:hand2)s6/s6 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal Df(Chr01:hand2)s6/s6 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Meckel's cartilage decreased length, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Meckel's cartilage morphology, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
pharyngeal arch 2 skeleton joint absent, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
mandibular arch skeleton joint absent, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
Meckel's cartilage tapered, abnormal hand2c99/c99 + MO1-dlx3b + MO1-dlx5a + MO3-dlx4b (AB) standard conditions Fig. 7 with image from Talbot et al., 2010
ceratobranchial 5 tooth decreased size, abnormal WT + MO1-dlx2a + MO1-dlx2b + MO1-dlx5a + MO3-dlx3b standard conditions Fig. 5 with image from Jackman et al., 2006
ceratobranchial 5 tooth deformed, abnormal WT + MO1-dlx2a + MO1-dlx2b + MO1-dlx5a + MO3-dlx3b standard conditions Fig. 5 with image from Jackman et al., 2006
otolith fused with otolith, abnormal WT + MO1-dlx2a + MO1-dlx2b + MO1-dlx5a + MO3-dlx3b standard conditions text only from Jackman et al., 2006
pharyngeal arch cartilage hypoplastic, abnormal WT + MO1-dlx2a + MO1-dlx2b + MO1-dlx5a + MO3-dlx3b standard conditions text only from Jackman et al., 2006
Citations