Morpholino

MO1-ccm2

ID

ZDB-MRPHLNO-060821-3

Name

MO1-ccm2

Previous Names

None

Target

Sequence

5' - GAAGCTGAGTAATACCTTAACTTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ccm2

No data available

Phenotype

Phenotype resulting from MO1-ccm2

Phenotype	Fish	Figures
blood vasculature obstructed, abnormal	y1Tg + MO1-ccm2	Fig. 4 from Kleaveland et al., 2009
blood vessel endothelial cell cell-cell junction decreased length, abnormal	WT + MO1-ccm2	Fig. S8 from Kleaveland et al., 2009
endothelial cell nucleus EGFP expression increased amount, abnormal	ig11Tg/ig11Tg; is5Tg/is5Tg + MO1-ccm2	Fig. 4 from Li et al., 2025
heart dilated, abnormal	y1Tg + MO1-ccm2	Figure 5 from Yang et al., 2023 Figure 3 - figure supplement 1 from Li et al., 2021 Fig. S5 from Choi et al., 2018 Fig. 2 from Zheng et al., 2010 Fig. 4 from Kleaveland et al., 2009
heart edematous, abnormal	y1Tg + MO1-ccm2	Fig. 4 from Kleaveland et al., 2009

Phenotype of all Fish created by or utilizing MO1-ccm2

Phenotype	Fish	Conditions	Figures
blood vessel endothelial cell cell-cell junction decreased length, abnormal	WT + MO1-ccm2	standard conditions	Fig. S8 from Kleaveland et al., 2009
heart dilated, abnormal	p150Tg + MO1-ccm2	standard conditions	Fig. 2 from Zheng et al., 2010
heart dilated, abnormal	twu34Tg + MO1-ccm2	standard conditions	Figure 5 from Yang et al., 2023 Fig. S5 from Choi et al., 2018
heart dilated, abnormal	y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-ccm2	standard conditions	Figure 6 from Li et al., 2021
caudal vein plexus dilated, abnormal	y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-ccm2	standard conditions	Figure 6 from Li et al., 2021
blood vasculature obstructed, abnormal	y1Tg + MO1-ccm2	standard conditions	Fig. 4 from Kleaveland et al., 2009
heart edematous, abnormal	y1Tg + MO1-ccm2	standard conditions	Fig. 4 from Kleaveland et al., 2009
heart dilated, abnormal	y1Tg + MO1-ccm2	standard conditions	Figure 3 - figure supplement 1 from Li et al., 2021 Fig. 4 from Kleaveland et al., 2009
endothelial cell nucleus EGFP expression increased amount, abnormal	ig11Tg/ig11Tg; is5Tg/is5Tg + MO1-ccm2	standard conditions	Fig. 4 from Li et al., 2025
heart dilated, abnormal	twu34Tg + MO1-ccm2 + MO1-map3k2	standard conditions	Fig. S5 from Choi et al., 2018
endothelial cell nucleus EGFP expression increased amount, abnormal	ig11Tg/ig11Tg; is5Tg/is5Tg + MO1-ccm2 + MO2-adrb1	standard conditions	Fig. 4 from Li et al., 2025

Citations