Morpholino

MO2-tll1

ID
ZDB-MRPHLNO-060818-7
Name
MO2-tll1
Previous Names
None
Target
Sequence
5' - GTAGTCCATCTGAGGTGTGAACGAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tll1
Expressed Gene Anatomy Figures
chrd Fig. 4 with image from Jasuja et al., 2006
gata2a Fig. 4 with image from Jasuja et al., 2006
Phenotype
Phenotype resulting from MO2-tll1
Phenotype Fish Figures
post-anal tail morphogenesis disrupted, abnormal WT + MO2-tll1 Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal WT + MO2-tll1 Fig. 3 with image from Yang et al., 2011
post-vent region deformed, abnormal WT + MO2-tll1 Fig. 3 with image from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal WT + MO2-tll1 Fig. 3 with image from Yang et al., 2011
Phenotype of all Fish created by or utilizing MO2-tll1
Phenotype Fish Conditions Figures
post-anal tail morphogenesis disrupted, abnormal WT + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal WT + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal WT + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-vent region deformed, abnormal WT + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal WT + MO1-cdh2 + MO2-tll1 standard conditions Fig. 5 with image from Yang et al., 2011
notochord morphogenesis disrupted, abnormal WT + MO1-cdh2 + MO2-tll1 standard conditions Fig. 5 with image from Yang et al., 2011
post-anal tail morphogenesis disrupted, abnormal WT + MO1-cdh2 + MO2-tll1 standard conditions Fig. 5 with image from Yang et al., 2011
post-vent region deformed, abnormal WT + MO1-cdh2 + MO2-tll1 standard conditions Fig. 5 with image from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal WT + MO1-cdh2 + MO2-tll1 standard conditions Fig. 5 with image from Yang et al., 2011
post-vent region deformed, abnormal WT + MO1-dvl2 + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal WT + MO1-dvl2 + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis disrupted, abnormal WT + MO1-dvl2 + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal WT + MO1-dvl2 + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-vent region deformed, abnormal WT + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal WT + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis disrupted, abnormal WT + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal WT + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis disrupted, abnormal WT + MO2-dvl1b + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal WT + MO2-dvl1b + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal WT + MO2-dvl1b + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-vent region deformed, abnormal WT + MO2-dvl1b + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis disrupted, abnormal WT + MO1-dvl2 + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-vent region deformed, abnormal WT + MO1-dvl2 + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal WT + MO1-dvl2 + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal WT + MO1-dvl2 + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.