header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060818-2
Morpholino Name: MO1-szl
Target: szl (1)
Previous Name: szz MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACAGCAGCAGACTGAATAGAGACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-szl No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-szl
Expressed Gene Anatomy Figures
chrd Fig. 5 from Muraoka et al., 2006
PHENOTYPE
Phenotype resulting from MO1-szl
Phenotype of all Fish created by or utilizing MO1-szl
OTHER MO1-szl MORPHOLINO PAGESNo links to external sites
CITATIONS (4)