Morpholino

MO1-myd88

ID

ZDB-MRPHLNO-060719-1

Name

MO1-myd88

Previous Names

None

Target

Sequence

5' - TAGCAAAACCTCTGTTATCCAGCGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

inhibits translation

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-myd88

Expressed Gene	Anatomy	Figures
cxcl8a	whole organism	Fig. 8 from Stockhammer et al., 2009
cxcl18b	whole organism	Fig. 8 from Stockhammer et al., 2009
defbl1	whole organism	Fig. 3 from Galindo-Villegas et al., 2012
efnb2a	artery	Fig. S5 from He et al., 2015
foxn1	thymic epithelium	Fig. 2 from He et al., 2015
gata1a	erythroid lineage cell	Fig. S5 from He et al., 2015
ifnphi1	whole organism	Fig. 8 from Stockhammer et al., 2009
il1b	whole organism	Fig. 3 , Fig. 5 from Galindo-Villegas et al., 2012 Fig. 8 from Stockhammer et al., 2009
irak3	whole organism	Fig. 8 from Stockhammer et al., 2009
kdrl	endothelial cell	Fig. S5 from He et al., 2015
lcp1	common myeloid progenitor macrophage	Fig. S5 from He et al., 2015 Fig. 3 from van der Sar et al., 2006
mmp9	whole organism	Fig. 8 from Stockhammer et al., 2009
mpx	immune system	Fig. 3 from van der Sar et al., 2006
rag1	T cell	Fig. 2 from He et al., 2015
runx1	ventral wall of dorsal aorta hematopoietic multipotent progenitor cell	Fig. 2, Fig. 3 from He et al., 2015
tal1	intermediate cell mass of mesoderm hematopoietic cell	Fig. S5 from He et al., 2015

Phenotype

Phenotype resulting from MO1-myd88

Phenotype	Fish	Figures
intermediate cell mass of mesoderm hematopoietic cell decreased amount, abnormal	la2Tg + MO1-myd88	Fig. 2 from He et al., 2015
T cell decreased amount, abnormal	TU + MO1-myd88	Fig. 2 from He et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal	hkz010tTg + MO1-myd88	Fig. 2, Fig. 3 from He et al., 2015

Phenotype of all Fish created by or utilizing MO1-myd88

Phenotype	Fish	Conditions	Figures
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal	TU + MO1-myd88	standard conditions	Fig. 2, Fig. 3 from He et al., 2015
T cell decreased amount, abnormal	TU + MO1-myd88	standard conditions	Fig. 2 from He et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal	hkz010tTg + MO1-myd88	control	Fig. 3 from He et al., 2015
intermediate cell mass of mesoderm hematopoietic cell decreased amount, abnormal	la2Tg + MO1-myd88	standard conditions	Fig. 2 from He et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal	s896Tg; zf169Tg + MO1-myd88	standard conditions	Fig. 2, Fig. 3 from He et al., 2015
neutrophil chemotaxis decreased efficacy, abnormal	mitfa^w2/w2; mpv17^a9/a9 + MO1-myd88	bacterial treatment by injection: Pseudomonas aeruginosa, hypotonic	Fig. 5 from Huang et al., 2018

Citations