Morpholino

MO1-rab11fip4a

ID
ZDB-MRPHLNO-060710-1
Name
MO1-rab11fip4a
Previous Names
  • MO1-rab11fip4 (1)
Target
Sequence
5' - GGAAGACATTGCCGTCCATCGTTGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rab11fip4a
Expressed Gene Anatomy Figures
atoh7 Fig. 5 with image from Muto et al., 2006
ccnd1 Fig. 4 with image from Muto et al., 2006
cdkn1ca Fig. 4 with image from Muto et al., 2006
egr2b Fig. 2 with image from Muto et al., 2006
en2a Fig. 2 with image from Muto et al., 2006
isl1a Fig. 5 with image from Muto et al., 2006
mab21l2 Fig. 2 with image from Muto et al., 2006
pax2a Fig. 2 with image from Muto et al., 2006
pax6a Fig. 2 with image from Muto et al., 2006
rx1 Fig. 2 with image from Muto et al., 2006
six3b Fig. 2 with image from Muto et al., 2006
vsx2 Fig. 2 with image from Muto et al., 2006
wnt1 Fig. 2 with image from Muto et al., 2006
Phenotype
Phenotype resulting from MO1-rab11fip4a
Phenotype Fish Figures
amacrine cell decreased amount, abnormal WT + MO1-rab11fip4a Fig. 5 with image from Muto et al., 2006
camera-type eye photoreceptor cell differentiation disrupted, abnormal WT + MO1-rab11fip4a Fig. 5 with image from Muto et al., 2006
cell population proliferation disrupted, abnormal WT + MO1-rab11fip4a Fig. 3 with image from Muto et al., 2006
eye decreased size, abnormal WT + MO1-rab11fip4a Fig. 2 with image from Muto et al., 2006
head decreased size, abnormal WT + MO1-rab11fip4a Fig. 2 with image from Muto et al., 2006
hindbrain apoptotic, abnormal WT + MO1-rab11fip4a Fig. 3 with image from Muto et al., 2006
mandibular arch skeleton physical object quality, abnormal WT + MO1-rab11fip4a Fig. 2 with image from Muto et al., 2006
pectoral fin decreased size, abnormal WT + MO1-rab11fip4a Fig. 2 with image from Muto et al., 2006
regulation of cell cycle disrupted, abnormal WT + MO1-rab11fip4a Fig. 4 with image from Muto et al., 2006
regulation of cell cycle process disrupted, abnormal WT + MO1-rab11fip4a Fig. 3 with image from Muto et al., 2006
retina apoptotic, abnormal WT + MO1-rab11fip4a Fig. S2 with image from Muto et al., 2006
retina cell decreased amount, abnormal WT + MO1-rab11fip4a Fig. 3 with image from Muto et al., 2006
retina development in camera-type eye delayed, abnormal WT + MO1-rab11fip4a Fig. 5 with image from Muto et al., 2006
retinal cone cell decreased amount, abnormal WT + MO1-rab11fip4a Fig. 5 with image from Muto et al., 2006
retinal ganglion cell decreased amount, abnormal WT + MO1-rab11fip4a Fig. 5 with image from Muto et al., 2006
spinal cord apoptotic, abnormal WT + MO1-rab11fip4a Fig. 3 with image from Muto et al., 2006
Phenotype of all Fish created by or utilizing MO1-rab11fip4a
Phenotype Fish Conditions Figures
amacrine cell decreased amount, abnormal WT + MO1-rab11fip4a standard conditions Fig. 5 with image from Muto et al., 2006
retinal ganglion cell decreased amount, abnormal WT + MO1-rab11fip4a standard conditions Fig. 5 with image from Muto et al., 2006
retinal cone cell decreased amount, abnormal WT + MO1-rab11fip4a standard conditions Fig. 5 with image from Muto et al., 2006
retina apoptotic, abnormal WT + MO1-rab11fip4a standard conditions Fig. S2 with image from Muto et al., 2006
eye decreased size, abnormal WT + MO1-rab11fip4a standard conditions Fig. 2 with image from Muto et al., 2006
retina development in camera-type eye delayed, abnormal WT + MO1-rab11fip4a standard conditions Fig. 5 with image from Muto et al., 2006
regulation of cell cycle process disrupted, abnormal WT + MO1-rab11fip4a standard conditions Fig. 3 with image from Muto et al., 2006
hindbrain apoptotic, abnormal WT + MO1-rab11fip4a standard conditions Fig. 3 with image from Muto et al., 2006
cell population proliferation disrupted, abnormal WT + MO1-rab11fip4a standard conditions Fig. 3 with image from Muto et al., 2006
regulation of cell cycle disrupted, abnormal WT + MO1-rab11fip4a standard conditions Fig. 4 with image from Muto et al., 2006
camera-type eye photoreceptor cell differentiation disrupted, abnormal WT + MO1-rab11fip4a standard conditions Fig. 5 with image from Muto et al., 2006
head decreased size, abnormal WT + MO1-rab11fip4a standard conditions Fig. 2 with image from Muto et al., 2006
pectoral fin decreased size, abnormal WT + MO1-rab11fip4a standard conditions Fig. 2 with image from Muto et al., 2006
spinal cord apoptotic, abnormal WT + MO1-rab11fip4a standard conditions Fig. 3 with image from Muto et al., 2006
mandibular arch skeleton physical object quality, abnormal WT + MO1-rab11fip4a standard conditions Fig. 2 with image from Muto et al., 2006
retina cell decreased amount, abnormal WT + MO1-rab11fip4a standard conditions Fig. 3 with image from Muto et al., 2006
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.