Morpholino

MO1-rab11fip4a

ID
ZDB-MRPHLNO-060710-1
Name
MO1-rab11fip4a
Previous Names
  • MO1-rab11fip4 (1)
Target
Sequence
5' - GGAAGACATTGCCGTCCATCGTTGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rab11fip4a
No data available
Phenotype
Phenotype resulting from MO1-rab11fip4a
Phenotype Fish Figures
amacrine cell decreased amount, abnormal WT + MO1-rab11fip4a Fig. 5 with image from Muto et al., 2006
camera-type eye photoreceptor cell differentiation disrupted, abnormal WT + MO1-rab11fip4a Fig. 5 with image from Muto et al., 2006
cell population proliferation disrupted, abnormal WT + MO1-rab11fip4a Fig. 3 with image from Muto et al., 2006
eye decreased size, abnormal WT + MO1-rab11fip4a Fig. 2 with image from Muto et al., 2006
head decreased size, abnormal WT + MO1-rab11fip4a Fig. 2 with image from Muto et al., 2006
hindbrain apoptotic, abnormal WT + MO1-rab11fip4a Fig. 3 with image from Muto et al., 2006
mandibular arch skeleton physical object quality, abnormal WT + MO1-rab11fip4a Fig. 2 with image from Muto et al., 2006
pectoral fin decreased size, abnormal WT + MO1-rab11fip4a Fig. 2 with image from Muto et al., 2006
regulation of cell cycle disrupted, abnormal WT + MO1-rab11fip4a Fig. 4 with image from Muto et al., 2006
regulation of cell cycle process disrupted, abnormal WT + MO1-rab11fip4a Fig. 3 with image from Muto et al., 2006
retina apoptotic, abnormal WT + MO1-rab11fip4a Fig. S2 with image from Muto et al., 2006
retina cell decreased amount, abnormal WT + MO1-rab11fip4a Fig. 3 with image from Muto et al., 2006
retina development in camera-type eye delayed, abnormal WT + MO1-rab11fip4a Fig. 5 with image from Muto et al., 2006
retinal cone cell decreased amount, abnormal WT + MO1-rab11fip4a Fig. 5 with image from Muto et al., 2006
retinal ganglion cell decreased amount, abnormal WT + MO1-rab11fip4a Fig. 5 with image from Muto et al., 2006
spinal cord apoptotic, abnormal WT + MO1-rab11fip4a Fig. 3 with image from Muto et al., 2006
Phenotype of all Fish created by or utilizing MO1-rab11fip4a
Phenotype Fish Conditions Figures
amacrine cell decreased amount, abnormal WT + MO1-rab11fip4a standard conditions Fig. 5 with image from Muto et al., 2006
retinal ganglion cell decreased amount, abnormal WT + MO1-rab11fip4a standard conditions Fig. 5 with image from Muto et al., 2006
retinal cone cell decreased amount, abnormal WT + MO1-rab11fip4a standard conditions Fig. 5 with image from Muto et al., 2006
retina apoptotic, abnormal WT + MO1-rab11fip4a standard conditions Fig. S2 with image from Muto et al., 2006
eye decreased size, abnormal WT + MO1-rab11fip4a standard conditions Fig. 2 with image from Muto et al., 2006
retina development in camera-type eye delayed, abnormal WT + MO1-rab11fip4a standard conditions Fig. 5 with image from Muto et al., 2006
regulation of cell cycle process disrupted, abnormal WT + MO1-rab11fip4a standard conditions Fig. 3 with image from Muto et al., 2006
hindbrain apoptotic, abnormal WT + MO1-rab11fip4a standard conditions Fig. 3 with image from Muto et al., 2006
cell population proliferation disrupted, abnormal WT + MO1-rab11fip4a standard conditions Fig. 3 with image from Muto et al., 2006
regulation of cell cycle disrupted, abnormal WT + MO1-rab11fip4a standard conditions Fig. 4 with image from Muto et al., 2006
camera-type eye photoreceptor cell differentiation disrupted, abnormal WT + MO1-rab11fip4a standard conditions Fig. 5 with image from Muto et al., 2006
head decreased size, abnormal WT + MO1-rab11fip4a standard conditions Fig. 2 with image from Muto et al., 2006
pectoral fin decreased size, abnormal WT + MO1-rab11fip4a standard conditions Fig. 2 with image from Muto et al., 2006
spinal cord apoptotic, abnormal WT + MO1-rab11fip4a standard conditions Fig. 3 with image from Muto et al., 2006
mandibular arch skeleton physical object quality, abnormal WT + MO1-rab11fip4a standard conditions Fig. 2 with image from Muto et al., 2006
retina cell decreased amount, abnormal WT + MO1-rab11fip4a standard conditions Fig. 3 with image from Muto et al., 2006
Citations