header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060620-3
Morpholino Name: MO1-otx2b
Target: otx2b (1)
Previous Names: MO1-otx2, Otx2 MO-Fluo (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTTGCTTGAGATACGACATCATGCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-otx2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-otx2b
Expressed Gene Anatomy Figures
dct Fig. 4 with image from Lane et al., 2012
foxa2 Fig. 3 with image from Tseng et al., 2011
foxa3 Fig. 3 with imageFig. 4 with image from Tseng et al., 2011
foxb1a Fig. 2 with image from Tseng et al., 2011
gata4 Fig. 4 with image from Tseng et al., 2011
gata5 Fig. 3 with imageFig. 4 with image from Tseng et al., 2011
gata6 Fig. 3 with imageFig. 4 with image from Tseng et al., 2011
mitfa Fig. 5 with image from Lane et al., 2012
mitfb Fig. 5 with image from Lane et al., 2012
prdm1a Fig. 4 with image from Tseng et al., 2011
sebox Fig. 3 with imageFig. 4 with image from Tseng et al., 2011
sox17 Fig. 3 with image from Tseng et al., 2011
sox32 Fig. 2 with imageFig. 3 with imageFig. 4 with image from Tseng et al., 2011
PHENOTYPE
Phenotype resulting from MO1-otx2b
No data available

Phenotype of all Fish created by or utilizing MO1-otx2b
Phenotype Fish Conditions Figures
optic fissure closure incomplete, abnormal WT + MO1-otx1 + MO1-otx2b standard conditions Fig. 2 with image from Lane et al., 2012
eye perforate, abnormal WT + MO1-otx1 + MO1-otx2b standard conditions Fig. 2 with image from Lane et al., 2012
eye pigmentation decreased occurrence, abnormal WT + MO1-otx2a + MO1-otx2b standard conditions Fig. 1 with image from Lane et al., 2012
retinal pigmented epithelium ventral region absent, abnormal WT + MO1-otx2a + MO1-otx2b standard conditions Fig. 3 with image from Lane et al., 2012
optic fissure closure incomplete, abnormal WT + MO1-otx2a + MO1-otx2b standard conditions Fig. 2 with image from Lane et al., 2012
eye perforate, abnormal WT + MO1-otx2a + MO1-otx2b standard conditions Fig. 1 with imageFig. 2 with image from Lane et al., 2012
retinal pigmented epithelium anterior side separated from retinal pigmented epithelium posterior side, abnormal WT + MO1-otx1 + MO1-otx2a + MO1-otx2b standard conditions Fig. 2 with image from Lane et al., 2012
retinal pigmented epithelium ventral region absent, abnormal WT + MO1-otx1 + MO1-otx2a + MO1-otx2b standard conditions Fig. 2 with image from Lane et al., 2012
rhombomere pax6a expression increased distribution, abnormal WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b standard conditions Fig. 11 with image from Albuixech-Crespo et al., 2017
forebrain pax6a expression increased distribution, abnormal WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b standard conditions Fig. 11 with image from Albuixech-Crespo et al., 2017
hindbrain pax6a expression increased distribution, abnormal WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b standard conditions Fig. 11 with image from Albuixech-Crespo et al., 2017
midbrain hindbrain boundary wnt1 expression absent, abnormal WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b standard conditions Fig. 11 with image from Albuixech-Crespo et al., 2017
midbrain pax6a expression increased distribution, abnormal WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b standard conditions Fig. 11 with image from Albuixech-Crespo et al., 2017
midbrain wnt1 expression decreased amount, abnormal WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b standard conditions Fig. 11 with image from Albuixech-Crespo et al., 2017
zona limitans intrathalamica shha expression absent, abnormal WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b standard conditions Fig. 11 with image from Albuixech-Crespo et al., 2017
OTHER MO1-otx2b MORPHOLINO PAGESNo links to external sites
CITATIONS (7)