Morpholino

MO3-foxd3

ID

ZDB-MRPHLNO-060522-7

Name

MO3-foxd3

Previous Names

foxd3-MO^5'UTR (1)

Target

foxd3 (1)

Sequence

5' - CACCGCGCACTTTGCTGCTGGAGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-foxd3

Expressed Gene	Anatomy	Figures
fscn1a	central nervous system cranial neural crest mesoderm	Fig. 1 from Boer et al., 2015
kita	melanoblast	Fig. 8 from Ignatius et al., 2008
mitfa	melanoblast	Fig. 8 from Ignatius et al., 2008
th	hindbrain locus coeruleus	Fig. S1 from Ignatius et al., 2008

Phenotype

Phenotype resulting from MO3-foxd3

Phenotype	Fish	Figures
sympathetic nervous system neuron absent, abnormal	WT + MO3-foxd3	Fig. S1 from Ignatius et al., 2008
sympathetic nervous system neuron decreased amount, abnormal	WT + MO3-foxd3	Fig. S1 from Ignatius et al., 2008
sympathetic neuron absent, abnormal	WT + MO3-foxd3	Fig. S1 from Ignatius et al., 2008

Phenotype of all Fish created by or utilizing MO3-foxd3

Phenotype	Fish	Conditions	Figures
iridophore decreased amount, abnormal	WT + MO2-foxd3 + MO3-foxd3	standard conditions	Fig. 8 from Montero-Balaguer et al., 2006
pharyngeal arch 2 skeleton malformed, abnormal	WT + MO2-foxd3 + MO3-foxd3	standard conditions	Fig. 8 from Montero-Balaguer et al., 2006
pharyngeal arch 3-7 skeleton decreased size, abnormal	WT + MO2-foxd3 + MO3-foxd3	standard conditions	Fig. 8 from Montero-Balaguer et al., 2006
Meckel's cartilage mislocalised ventrally, abnormal	WT + MO2-foxd3 + MO3-foxd3	standard conditions	Fig. 8 from Montero-Balaguer et al., 2006
pharyngeal arch 3-7 skeleton malformed, abnormal	WT + MO2-foxd3 + MO3-foxd3	standard conditions	Fig. 8 from Montero-Balaguer et al., 2006
sympathetic nervous system neuron absent, abnormal	WT + MO3-foxd3	standard conditions	Fig. S1 from Ignatius et al., 2008
sympathetic nervous system neuron decreased amount, abnormal	WT + MO3-foxd3	standard conditions	Fig. S1 from Ignatius et al., 2008
sympathetic neuron absent, abnormal	WT + MO3-foxd3	standard conditions	Fig. S1 from Ignatius et al., 2008
eye morphology, abnormal	hdac1^b382/b382 + MO3-foxd3	standard conditions	Fig. S3 from Ignatius et al., 2008
pharyngeal arch cartilage absent, abnormal	WT + MO2-foxd3 + MO3-foxd3 + MO4-tfap2a	standard conditions	Fig. 4 from Chen et al., 2014
pharyngeal arch tendon absent, abnormal	WT + MO2-foxd3 + MO3-foxd3 + MO4-tfap2a	standard conditions	Fig. 4 from Chen et al., 2014
eye morphology, abnormal	hdac1^b382/b382; foxd3^zdf10/+ + MO3-foxd3	standard conditions	Fig. S3 from Ignatius et al., 2008
melanocyte increased amount, abnormal	hdac1^b382/b382; foxd3^zdf10/+ + MO3-foxd3	standard conditions	Fig. S3 from Ignatius et al., 2008
melanophore stripe melanocyte decreased amount, abnormal	hdac1^b382/b382; foxd3^zdf10/zdf10 + MO3-foxd3	standard conditions	Fig. S3 from Ignatius et al., 2008
yolk melanophore stripe absent, abnormal	hdac1^b382/b382; foxd3^zdf10/zdf10 + MO3-foxd3	standard conditions	Fig. S3 from Ignatius et al., 2008
melanophore stripe decreased amount, abnormal	hdac1^b382/b382; foxd3^zdf10/zdf10 + MO3-foxd3	standard conditions	Fig. S3 from Ignatius et al., 2008
melanocyte position, abnormal	hdac1^b382/b382; foxd3^zdf10/zdf10 + MO3-foxd3	standard conditions	Fig. S3 from Ignatius et al., 2008
eye morphology, abnormal	hdac1^b382/b382; foxd3^zdf10/zdf10 + MO3-foxd3	standard conditions	Fig. S3 from Ignatius et al., 2008
melanocyte decreased amount, abnormal	hdac1^b382/b382; foxd3^zdf10/zdf10 + MO3-foxd3	standard conditions	Fig. S3 from Ignatius et al., 2008

Citations