Morpholino

MO3-foxd3

ID
ZDB-MRPHLNO-060522-7
Name
MO3-foxd3
Previous Names
  • foxd3-MO5'UTR (1)
Target
Sequence
5' - CACCGCGCACTTTGCTGCTGGAGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-foxd3
No data available
Phenotype
Phenotype resulting from MO3-foxd3
Phenotype of all Fish created by or utilizing MO3-foxd3
Phenotype Fish Conditions Figures
iridophore decreased amount, abnormal WT + MO2-foxd3 + MO3-foxd3 standard conditions Fig. 8 with image from Montero-Balaguer et al., 2006
pharyngeal arch 2 skeleton malformed, abnormal WT + MO2-foxd3 + MO3-foxd3 standard conditions Fig. 8 with image from Montero-Balaguer et al., 2006
pharyngeal arch 3-7 skeleton decreased size, abnormal WT + MO2-foxd3 + MO3-foxd3 standard conditions Fig. 8 with image from Montero-Balaguer et al., 2006
Meckel's cartilage mislocalised ventrally, abnormal WT + MO2-foxd3 + MO3-foxd3 standard conditions Fig. 8 with image from Montero-Balaguer et al., 2006
pharyngeal arch 3-7 skeleton malformed, abnormal WT + MO2-foxd3 + MO3-foxd3 standard conditions Fig. 8 with image from Montero-Balaguer et al., 2006
sympathetic nervous system neuron absent, abnormal WT + MO3-foxd3 standard conditions Fig. S1 with image from Ignatius et al., 2008
sympathetic nervous system neuron decreased amount, abnormal WT + MO3-foxd3 standard conditions Fig. S1 with image from Ignatius et al., 2008
sympathetic neuron absent, abnormal WT + MO3-foxd3 standard conditions Fig. S1 with image from Ignatius et al., 2008
eye morphology, abnormal hdac1b382/b382 + MO3-foxd3 standard conditions Fig. S3 with image from Ignatius et al., 2008
pharyngeal arch cartilage absent, abnormal WT + MO2-foxd3 + MO3-foxd3 + MO4-tfap2a standard conditions Fig. 4 with image from Chen et al., 2014
pharyngeal arch tendon absent, abnormal WT + MO2-foxd3 + MO3-foxd3 + MO4-tfap2a standard conditions Fig. 4 with image from Chen et al., 2014
eye morphology, abnormal hdac1b382/b382; foxd3zdf10/+ + MO3-foxd3 standard conditions Fig. S3 with image from Ignatius et al., 2008
melanocyte increased amount, abnormal hdac1b382/b382; foxd3zdf10/+ + MO3-foxd3 standard conditions Fig. S3 with image from Ignatius et al., 2008
melanophore stripe melanocyte decreased amount, abnormal hdac1b382/b382; foxd3zdf10/zdf10 + MO3-foxd3 standard conditions Fig. S3 with image from Ignatius et al., 2008
yolk melanophore stripe absent, abnormal hdac1b382/b382; foxd3zdf10/zdf10 + MO3-foxd3 standard conditions Fig. S3 with image from Ignatius et al., 2008
melanophore stripe decreased amount, abnormal hdac1b382/b382; foxd3zdf10/zdf10 + MO3-foxd3 standard conditions Fig. S3 with image from Ignatius et al., 2008
melanocyte position, abnormal hdac1b382/b382; foxd3zdf10/zdf10 + MO3-foxd3 standard conditions Fig. S3 with image from Ignatius et al., 2008
eye morphology, abnormal hdac1b382/b382; foxd3zdf10/zdf10 + MO3-foxd3 standard conditions Fig. S3 with image from Ignatius et al., 2008
melanocyte decreased amount, abnormal hdac1b382/b382; foxd3zdf10/zdf10 + MO3-foxd3 standard conditions Fig. S3 with image from Ignatius et al., 2008
Citations