Morpholino

MO1-ctnnb2

ID
ZDB-MRPHLNO-060414-4
Name
MO1-ctnnb2
Previous Names
  • b-catenin-2 MO2 (1)
Target
Sequence
5' - CCTTTAGCCTGAGCGACTTCCAAAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ctnnb2
Expressed Gene Anatomy Figures
axin2 Fig. 6 from Lin et al., 2015
chrd Fig 4 with image from He et al., 2020
Fig. 5 with image from Xing et al., 2018
Fig. 6 from Lin et al., 2015
Fig. 2 with image from Varga et al., 2007
ctnnb2 Fig. 7 from Lin et al., 2015
dharma Fig 4 with image from He et al., 2020
Fig. 5 with image from Bellipanni et al., 2006
fgf3 Fig. 6 from Lin et al., 2015
fgf8a Fig. 6 from Lin et al., 2015
Fig. 8 with image from Toruń et al., 2015
gata1a Fig. 7 from Yeh et al., 2009
gsc Fig. 5 with image from Xing et al., 2018
hoxb1b Fig. 8 with image from Jia et al., 2009
mpx Fig. 7 from Yeh et al., 2009
ndr1 Fig. 5 with image from Bellipanni et al., 2006
nog1 Fig. 2 with image from Varga et al., 2007
otx2b Fig. 8 with image from Jia et al., 2009
sox2 Fig. 8 with image from Jia et al., 2009
sp5l Fig. 6 from Lin et al., 2015
tbxta Fig. 5 with image from Xing et al., 2018
wnt3a Fig. 7 from Lin et al., 2015
wnt8a Fig. 7 from Lin et al., 2015
Phenotype
Phenotype resulting from MO1-ctnnb2
Phenotype Fish Figures
axis specification arrested, abnormal WT + MO1-ctnnb2 Fig. 4 with image from Bellipanni et al., 2006
brain fgf8a expression decreased amount, abnormal AB + MO1-ctnnb2 Fig. 8 with image from Toruń et al., 2015
caudal fin fgf8a expression decreased amount, abnormal AB + MO1-ctnnb2 Fig. 8 with image from Toruń et al., 2015
caudal fin multiple, abnormal WT + MO1-ctnnb2 Fig. 4 with image from Bellipanni et al., 2006
embryonic camera-type eye development disrupted, abnormal WT + MO1-ctnnb2 Fig. 4 with image from Bellipanni et al., 2006
eye aplastic, abnormal WT + MO1-ctnnb2 Fig. 4 with image from Bellipanni et al., 2006
forebrain aplastic, abnormal WT + MO1-ctnnb2 Fig. 4 with image from Bellipanni et al., 2006
forebrain development disrupted, abnormal WT + MO1-ctnnb2 Fig. 4 with image from Bellipanni et al., 2006
head necrotic, abnormal WT + MO1-ctnnb2 Fig. 4 with image from Bellipanni et al., 2006
neural tube distended, abnormal WT + MO1-ctnnb2 Fig. 4 with image from Bellipanni et al., 2006
notochord aplastic, abnormal WT + MO1-ctnnb2 Fig. 4 with image from Bellipanni et al., 2006
spinal cord decreased length, abnormal WT + MO1-ctnnb2 Fig. 4 with image from Bellipanni et al., 2006
spinal cord decreased width, abnormal WT + MO1-ctnnb2 Fig. 4 with image from Bellipanni et al., 2006
whole organism gsc expression absent, abnormal WT + MO1-ctnnb2 Fig. 5 with image from Xing et al., 2018
whole organism chrd expression absent, abnormal WT + MO1-ctnnb2 Fig. 5 with image from Xing et al., 2018
whole organism axin2 expression decreased amount, abnormal AB + MO1-ctnnb2 Fig. 6 from Lin et al., 2015
whole organism fgf3 expression decreased amount, abnormal AB + MO1-ctnnb2 Fig. 6 from Lin et al., 2015
whole organism wnt3a expression decreased amount, abnormal AB + MO1-ctnnb2 Fig. 7 from Lin et al., 2015
whole organism wnt8a expression decreased amount, abnormal AB + MO1-ctnnb2 Fig. 7 from Lin et al., 2015
whole organism fgf8a expression decreased amount, abnormal AB + MO1-ctnnb2 Fig. 6 from Lin et al., 2015
whole organism sp5l expression decreased amount, abnormal AB + MO1-ctnnb2 Fig. 6 from Lin et al., 2015
whole organism chrd expression decreased amount, abnormal AB + MO1-ctnnb2 Fig. 6 from Lin et al., 2015
whole organism ventralized, abnormal AB + MO1-ctnnb2 Fig. S8 from Lin et al., 2015
whole organism wholly ventralized, abnormal WT + MO1-ctnnb2 Fig. 4 with image from Bellipanni et al., 2006
whole organism dorsal region chrd expression decreased distribution, abnormal AB + MO1-ctnnb2 Fig. 6 from Lin et al., 2015
whole organism posterior region malformed, abnormal AB + MO1-ctnnb2 Fig. 8 with image from Toruń et al., 2015
Phenotype of all Fish created by or utilizing MO1-ctnnb2
Phenotype Fish Conditions Figures
whole organism posterior region malformed, abnormal AB + MO1-ctnnb2 standard conditions Fig. 8 with image from Toruń et al., 2015
whole organism wnt8a expression decreased amount, abnormal AB + MO1-ctnnb2 standard conditions Fig. 7 from Lin et al., 2015
whole organism fgf3 expression decreased amount, abnormal AB + MO1-ctnnb2 standard conditions Fig. 6 from Lin et al., 2015
whole organism ventralized, abnormal AB + MO1-ctnnb2 standard conditions Fig. S8 from Lin et al., 2015
whole organism axin2 expression decreased amount, abnormal AB + MO1-ctnnb2 standard conditions Fig. 6 from Lin et al., 2015
whole organism fgf8a expression decreased amount, abnormal AB + MO1-ctnnb2 standard conditions Fig. 6 from Lin et al., 2015
whole organism chrd expression decreased amount, abnormal AB + MO1-ctnnb2 standard conditions Fig. 6 from Lin et al., 2015
whole organism sp5l expression decreased amount, abnormal AB + MO1-ctnnb2 standard conditions Fig. 6 from Lin et al., 2015
caudal fin fgf8a expression decreased amount, abnormal AB + MO1-ctnnb2 control Fig. 8 with image from Toruń et al., 2015
whole organism dorsal region chrd expression decreased distribution, abnormal AB + MO1-ctnnb2 standard conditions Fig. 6 from Lin et al., 2015
whole organism wnt3a expression decreased amount, abnormal AB + MO1-ctnnb2 standard conditions Fig. 7 from Lin et al., 2015
brain fgf8a expression decreased amount, abnormal AB + MO1-ctnnb2 control Fig. 8 with image from Toruń et al., 2015
neural tube distended, abnormal WT + MO1-ctnnb2 standard conditions Fig. 4 with image from Bellipanni et al., 2006
notochord aplastic, abnormal WT + MO1-ctnnb2 standard conditions Fig. 4 with image from Bellipanni et al., 2006
axis specification arrested, abnormal WT + MO1-ctnnb2 standard conditions Fig. 4 with image from Bellipanni et al., 2006
caudal fin multiple, abnormal WT + MO1-ctnnb2 standard conditions Fig. 4 with image from Bellipanni et al., 2006
forebrain development disrupted, abnormal WT + MO1-ctnnb2 standard conditions Fig. 4 with image from Bellipanni et al., 2006
spinal cord decreased width, abnormal WT + MO1-ctnnb2 standard conditions Fig. 4 with image from Bellipanni et al., 2006
head necrotic, abnormal WT + MO1-ctnnb2 standard conditions Fig. 4 with image from Bellipanni et al., 2006
whole organism gsc expression absent, abnormal WT + MO1-ctnnb2 standard conditions Fig. 5 with image from Xing et al., 2018
spinal cord decreased length, abnormal WT + MO1-ctnnb2 standard conditions Fig. 4 with image from Bellipanni et al., 2006
whole organism chrd expression absent, abnormal WT + MO1-ctnnb2 standard conditions Fig. 5 with image from Xing et al., 2018
whole organism wholly ventralized, abnormal WT + MO1-ctnnb2 standard conditions Fig. 4 with image from Bellipanni et al., 2006
forebrain aplastic, abnormal WT + MO1-ctnnb2 standard conditions Fig. 4 with image from Bellipanni et al., 2006
embryonic camera-type eye development disrupted, abnormal WT + MO1-ctnnb2 standard conditions Fig. 4 with image from Bellipanni et al., 2006
eye aplastic, abnormal WT + MO1-ctnnb2 standard conditions Fig. 4 with image from Bellipanni et al., 2006
whole organism morphology, ameliorated ctnnb2tpl149/+ + MO1-ctnnb2 + MO2-ctnnb1 standard conditions Figure 2 with image from Cunningham et al., 2020
whole organism dharma expression position, ameliorated nanogihb97/ihb97 + MO1-ctnnb2 standard conditions Fig 4 with image from He et al., 2020
whole organism dorsalized, ameliorated nanogihb97/ihb97 + MO1-ctnnb2 standard conditions Fig 4 with image from He et al., 2020
whole organism chrd expression position, ameliorated nanogihb97/ihb97 + MO1-ctnnb2 standard conditions Fig 4 with image from He et al., 2020
whole organism dharma expression amount, ameliorated nanogihb97/ihb97 + MO1-ctnnb2 standard conditions Fig 4 with image from He et al., 2020
whole organism chrd expression amount, ameliorated nanogihb97/ihb97 + MO1-ctnnb2 standard conditions Fig 4 with image from He et al., 2020
whole organism chrd expression position, ameliorated nanogihb98/ihb98 + MO1-ctnnb2 standard conditions Fig 4 with image from He et al., 2020
whole organism dorsalized, ameliorated nanogihb98/ihb98 + MO1-ctnnb2 standard conditions Fig 4 with image from He et al., 2020
whole organism dharma expression amount, ameliorated nanogihb98/ihb98 + MO1-ctnnb2 standard conditions Fig 4 with image from He et al., 2020
whole organism chrd expression amount, ameliorated nanogihb98/ihb98 + MO1-ctnnb2 standard conditions Fig 4 with image from He et al., 2020
whole organism dharma expression position, ameliorated nanogihb98/ihb98 + MO1-ctnnb2 standard conditions Fig 4 with image from He et al., 2020
whole organism dorsal region chrd expression spatial pattern, ameliorated AB + MO1-cdk5rap3 + MO1-ctnnb2 standard conditions Fig. 6 from Lin et al., 2015
whole organism chrd expression amount, ameliorated AB + MO1-cdk5rap3 + MO1-ctnnb2 standard conditions Fig. 6 from Lin et al., 2015
whole organism fgf3 expression amount, ameliorated AB + MO1-cdk5rap3 + MO1-ctnnb2 standard conditions Fig. 6 from Lin et al., 2015
whole organism axin2 expression amount, ameliorated AB + MO1-cdk5rap3 + MO1-ctnnb2 standard conditions Fig. 6 from Lin et al., 2015
whole organism fgf8a expression amount, ameliorated AB + MO1-cdk5rap3 + MO1-ctnnb2 standard conditions Fig. 6 from Lin et al., 2015
whole organism malformed, ameliorated AB + MO1-cdk5rap3 + MO1-ctnnb2 standard conditions Fig. S8 from Lin et al., 2015
whole organism sp5l expression amount, ameliorated AB + MO1-cdk5rap3 + MO1-ctnnb2 standard conditions Fig. 6 from Lin et al., 2015
whole organism dorsal region chrd expression amount, ameliorated AB + MO1-cdk5rap3 + MO1-ctnnb2 standard conditions Fig. 6 from Lin et al., 2015
whole organism ventralized, abnormal AB + MO1-cdk5rap3 + MO1-ctnnb2 standard conditions Fig. S8 from Lin et al., 2015
whole organism morphology, abnormal WT + MO1-ctnnb2 + MO2-ctnnb1 standard conditions Figure 2 with image from Cunningham et al., 2020
dorsal/ventral axis specification disrupted, abnormal WT + MO1-ctnnb2 + MO2-ctnnb1 standard conditions Fig. 6 with image from Bellipanni et al., 2006
whole organism wholly dorsalized, abnormal WT + MO1-ctnnb2 + MO2-ctnnb1 standard conditions Fig. 6 with image from Bellipanni et al., 2006
trunk vasculature dll4 expression amount, ameliorated WT + MO1-ctnnb1 + MO1-ctnnb2 + MO1-ptger3 standard conditions Fig. 4 from Chen et al., 2017
post-vent region morphology, abnormal brsb2; ctnnb2p1/p1 + MO1-ctnnb2 + MO2-ctnnb1 standard conditions Fig. 3 with image from Varga et al., 2007
whole organism wholly ventralized, abnormal brsb2; ctnnb2p1/p1 + MO1-ctnnb2 + MO2-ctnnb1 standard conditions Fig. 3 with image from Varga et al., 2007
post-vent region morphology, abnormal brsb2; ctnnb2p1/p1 + MO1-chrd + MO1-ctnnb2 + MO2-ctnnb1 standard conditions Fig. 3 with image from Varga et al., 2007
whole organism wholly ventralized, abnormal brsb2; ctnnb2p1/p1 + MO1-chrd + MO1-ctnnb2 + MO2-ctnnb1 standard conditions Fig. 3 with image from Varga et al., 2007
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.