header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060321-1
Morpholino Name: MO1-gsc
Target: gsc (1)
Sequence:
5' - CAAGCGAAAAGATGTGTGAGATTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-gsc No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-gsc
Expressed Gene Anatomy Figures
foxi1 Fig. 4 with image from Seiliez et al., 2006
frzb Fig. 5 with image from Seiliez et al., 2006
pax2a Fig. 4 with image from Seiliez et al., 2006
tbxta Fig. 7 with image from Dixon Fox et al., 2009
wnt8a Fig. 7 with image from Dixon Fox et al., 2009
Fig. 5 with image from Seiliez et al., 2006
PHENOTYPE
Phenotype resulting from MO1-gsc
Phenotype of all Fish created by or utilizing MO1-gsc
Phenotype Fish Conditions Figures
head hypoplastic, abnormal WT + MO1-gsc standard conditions Fig. 2 with image from Seiliez et al., 2006
head morphogenesis disrupted, abnormal WT + MO1-gsc standard conditions Fig. 2 with image from Seiliez et al., 2006
eye fused with eye, abnormal WT + MO1-gsc standard conditions Fig. 2 with image from Seiliez et al., 2006
head truncated, abnormal WT + MO1-gsc standard conditions Fig. 2 with image from Seiliez et al., 2006
whole organism wholly ventralized, abnormal chrdtt250/tt250 + MO1-gsc standard conditions Fig. 7 with image from Dixon Fox et al., 2009
notochord truncated, abnormal chrdtt250/tt250 + MO1-gsc standard conditions Fig. 7 with image from Dixon Fox et al., 2009
whole organism wholly ventralized, abnormal AB + MO1-chrd + MO1-gsc standard conditions Fig. 7 with image from Dixon Fox et al., 2009
head decreased size, abnormal AB + MO1-chrd + MO1-gsc standard conditions Fig. 7 with image from Dixon Fox et al., 2009
notochord decreased width, abnormal AB + MO1-chrd + MO1-gsc standard conditions Fig. 7 with image from Dixon Fox et al., 2009
notochord truncated, abnormal AB + MO1-chrd + MO1-gsc standard conditions Fig. 7 with image from Dixon Fox et al., 2009
eye fused with eye, abnormal WT + MO1-foxa3 + MO1-gsc standard conditions Fig. 2 with imageFig. 6 with image from Seiliez et al., 2006
midbrain aplastic, abnormal WT + MO1-foxa3 + MO1-gsc standard conditions Fig. 2 with image from Seiliez et al., 2006
head aplastic, abnormal WT + MO1-foxa3 + MO1-gsc standard conditions Fig. 2 with image from Seiliez et al., 2006
forebrain aplastic, abnormal WT + MO1-foxa3 + MO1-gsc standard conditions Fig. 2 with image from Seiliez et al., 2006
head morphogenesis disrupted, abnormal WT + MO1-foxa3 + MO1-gsc standard conditions Fig. 2 with imageFig. 6 with image from Seiliez et al., 2006
head truncated, abnormal WT + MO1-foxa3 + MO1-gsc standard conditions Fig. 6 with image from Seiliez et al., 2006
midbrain hindbrain boundary aplastic, abnormal WT + MO1-foxa3 + MO1-gsc standard conditions Fig. 2 with image from Seiliez et al., 2006
head truncated, abnormal WT + MO1-foxa3 + MO1-gsc + MO1-wnt8a standard conditions Fig. 6 with image from Seiliez et al., 2006
eye fused with eye, abnormal WT + MO1-foxa3 + MO1-gsc + MO1-wnt8a standard conditions Fig. 6 with image from Seiliez et al., 2006
whole organism wholly ventralized, abnormal chrdtt250/tt250 + MO1-gsc + MO1-nog1 + MO5-fstl1b standard conditions Fig. S3 with image from Dixon Fox et al., 2009
OTHER MO1-gsc MORPHOLINO PAGES No links to external sites
CITATIONS (3)