Morpholino

MO1-dmd

ID
ZDB-MRPHLNO-060220-1
Name
MO1-dmd
Previous Names
None
Target
Sequence
5' - TTGAGTCCTTTAATCCTACAATTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This morpholino has a 1 bp mismatch to Ensembl sequence, which may be due to a polymorphism. Correspondence with author Guyon indicates that the published sequence of the morpholino is correct and that it matches the sequence of their cDNA.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dmd
No data available
Phenotype
Phenotype resulting from MO1-dmd
Phenotype of all Fish created by or utilizing MO1-dmd
Phenotype Fish Conditions Figures
muscle broken, abnormal dmdta222a/ta222a + MO1-dmd + MO6-dmd standard conditions Fig. 2 with image from Johnson et al., 2013
whole organism pax7b expression amount, ameliorated AB + MO1-dmd + MO6-dmd chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor Fig. 2 from Spreafico et al., 2021
alpha-tubulin acetylation occurrence, ameliorated AB + MO1-dmd + MO6-dmd chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor Fig. 5 from Spreafico et al., 2021
skeletal muscle lesioned, abnormal AB + MO1-dmd + MO6-dmd control Fig. 2 from Spreafico et al., 2021
whole organism pax7b expression increased amount, abnormal AB + MO1-dmd + MO6-dmd control Fig. 2 from Spreafico et al., 2021
whole organism mylpfa expression decreased amount, abnormal AB + MO1-dmd + MO6-dmd control Fig. 2 from Spreafico et al., 2021
whole organism mylpfa expression amount, ameliorated AB + MO1-dmd + MO6-dmd chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor Fig. 2 from Spreafico et al., 2021
skeletal muscle lesioned, ameliorated AB + MO1-dmd + MO6-dmd chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor Fig. 2 from Spreafico et al., 2021
whole organism pax3b expression amount, ameliorated AB + MO1-dmd + MO6-dmd chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor Fig. 2 from Spreafico et al., 2021
whole organism hdac8 expression increased amount, abnormal AB + MO1-dmd + MO6-dmd standard conditions Fig. 2 from Spreafico et al., 2021
alpha-tubulin acetylation decreased occurrence, abnormal AB + MO1-dmd + MO6-dmd control Fig. 5 from Spreafico et al., 2021
whole organism pax3a expression amount, ameliorated AB + MO1-dmd + MO6-dmd chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor Fig. 2 from Spreafico et al., 2021
whole organism pax3a expression increased amount, abnormal AB + MO1-dmd + MO6-dmd control Fig. 2 from Spreafico et al., 2021
whole organism pax7a expression amount, ameliorated AB + MO1-dmd + MO6-dmd chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor Fig. 2 from Spreafico et al., 2021
whole organism pax3b expression increased amount, abnormal AB + MO1-dmd + MO6-dmd control Fig. 2 from Spreafico et al., 2021
muscle cell increased width, abnormal AB + MO1-dmd + MO6-dmd control Fig. 5 from Spreafico et al., 2021
whole organism pax7a expression increased amount, abnormal AB + MO1-dmd + MO6-dmd control Fig. 2 from Spreafico et al., 2021
muscle cell increased width, ameliorated AB + MO1-dmd + MO6-dmd chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor Fig. 5 from Spreafico et al., 2021
whole organism crebbpb expression decreased amount, abnormal WT + MO1-dmd + MO6-dmd standard conditions Fig. 1 with image from Bajanca et al., 2017
somite border dmd expression absent, abnormal WT + MO1-dmd + MO6-dmd standard conditions Fig. 1 with image from Bajanca et al., 2017
whole organism ep300b expression decreased amount, abnormal WT + MO1-dmd + MO6-dmd standard conditions Fig. 1 with image from Bajanca et al., 2017
myotome broken, abnormal WT + MO1-dmd + MO6-dmd standard conditions Fig. 3 with image from Johnson et al., 2013
whole organism ep300a expression decreased amount, abnormal WT + MO1-dmd + MO6-dmd standard conditions Fig. 1 with image from Bajanca et al., 2017
skeletal muscle cell disorganized, abnormal WT + MO1-dmd + MO6-dmd standard conditions Fig. 1 with image from Bajanca et al., 2017
muscle broken, abnormal WT + MO1-dmd + MO6-dmd standard conditions Fig. 2 with imageFig. 3 with image from Johnson et al., 2013
whole organism fstb expression decreased amount, abnormal WT + MO1-dmd + MO6-dmd chemical treatment by environment: trichostatin A Fig. 1 with image from Bajanca et al., 2017
skeletal muscle cell organization quality, ameliorated WT + MO1-dmd + MO6-dmd chemical treatment by environment: trichostatin A Fig. 1 with image from Bajanca et al., 2017
whole organism crebbpa expression decreased amount, abnormal WT + MO1-dmd + MO6-dmd chemical treatment by environment: trichostatin A Fig. 1 with image from Bajanca et al., 2017
muscle broken, abnormal zf13Tg + MO1-dmd standard conditions Fig. 1 with image from Johnson et al., 2013
muscle broken, abnormal zf13Tg + MO1-dmd + MO6-dmd standard conditions Fig. 2 with imageFig. 3 with imageFig. 4 with image from Johnson et al., 2013
myotome broken, abnormal zf13Tg + MO1-dmd + MO6-dmd standard conditions Fig. 3 with imageFig. 4 with image from Johnson et al., 2013
muscle broken, abnormal zf13Tg + MO1-dmd + MO6-dmd chemical treatment: pharmaceutical Fig. 5 with image from Johnson et al., 2013
myotome neutrophil amount, ameliorated zf13Tg + MO1-dmd + MO6-dmd (AB) chemical treatment by environment: EC 3.5.1.98 (histone deacetylase) inhibitor Fig. 3 from Spreafico et al., 2021
myotome neutrophil increased amount, abnormal zf13Tg + MO1-dmd + MO6-dmd (AB) control Fig. 3 from Spreafico et al., 2021
Citations