Morpholino

MO1-ptenb

ID

ZDB-MRPHLNO-060214-7

Name

MO1-ptenb

Previous Names

None

Target

ptenb (1)

Sequence

5' - CTTTCGGACGGTCGGTCGTCTTTA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ptenb

Expressed Gene	Anatomy	Figures
lcp1	macrophage	Fig. 5 from Fu et al., 2010

Phenotype

Phenotype resulting from MO1-ptenb

Phenotype	Fish	Figures
actin filament polymerization increased occurrence, abnormal	AB/TU + MO1-ptenb	Fig. 10 from Yeh et al., 2011
blood decreased fluid flow, abnormal	WT + MO1-ptenb	Fig. 7 from Croushore et al., 2005
caudal fin falciform, abnormal	WT + MO1-ptenb	Fig. 7 from Croushore et al., 2005
convergent extension involved in gastrulation disrupted, abnormal	AB/TU + MO1-ptenb	Fig. 6 , Fig. 7 , text only from Yeh et al., 2011
dorsal convergence disrupted, abnormal	AB/TU + MO1-ptenb	Fig. 5 , Fig. 7 from Yeh et al., 2011
epiboly involved in gastrulation with mouth forming second delayed, abnormal	AB/TU + MO1-ptenb	Fig. 3 from Yeh et al., 2011
extension decreased length, abnormal	WT + MO1-ptenb	Fig. 7 from Croushore et al., 2005
gastrulation disrupted, abnormal	AB/TU + MO1-ptenb	Fig. 4 from Yeh et al., 2011
head domed, abnormal	WT + MO1-ptenb	Fig. 7 from Croushore et al., 2005
hypoblast cell projection direction, abnormal	AB/TU + MO1-ptenb	Fig. 8 from Yeh et al., 2011
hypoblast cell projection physical object quality, abnormal	AB/TU + MO1-ptenb	Fig. 8 from Yeh et al., 2011
intersegmental vessel malformed, abnormal	WT + MO1-ptenb	Fig. 7 from Croushore et al., 2005
lipid phosphatase activity disrupted, abnormal	WT + MO1-ptenb	Fig. 8 from Croushore et al., 2005
macrophage decreased amount, abnormal	WT + MO1-ptenb	Fig. 5 from Fu et al., 2010
myeloid lineage restricted progenitor cell mislocalised, abnormal	zdf11Tg + MO1-ptenb	Fig. 5 from Fu et al., 2010
notochord undulate, abnormal	WT + MO1-ptenb	Fig. 7 from Croushore et al., 2005
phosphatidylinositol dephosphorylation decreased occurrence, abnormal	WT + MO1-ptenb	Fig. 8 from Croushore et al., 2005
post-vent region curved dorsal, abnormal	WT + MO1-ptenb	Fig. 7 from Croushore et al., 2005
post-vent region decreased length, abnormal	AB/TU + MO1-ptenb	Fig. 4 from Yeh et al., 2011
somite increased width, abnormal	AB/TU + MO1-ptenb	Fig. 5 , text only from Yeh et al., 2011
whole organism decreased length, abnormal	AB/TU + MO1-ptenb	Fig. 4 from Yeh et al., 2011

Phenotype of all Fish created by or utilizing MO1-ptenb

Phenotype	Fish	Conditions	Figures
somite increased width, abnormal	ptenb^{hu1435/hu1435} + MO1-ptenb	standard conditions	text only from Yeh et al., 2011
convergent extension involved in gastrulation disrupted, abnormal	ptenb^{hu1435/hu1435} + MO1-ptenb	standard conditions	text only from Yeh et al., 2011
hypoblast cell projection direction, abnormal	AB/TU + MO1-ptenb	standard conditions	Fig. 8 from Yeh et al., 2011
epiboly involved in gastrulation with mouth forming second delayed, abnormal	AB/TU + MO1-ptenb	standard conditions	Fig. 3 from Yeh et al., 2011
somite increased width, abnormal	AB/TU + MO1-ptenb	standard conditions	Fig. 5 from Yeh et al., 2011
convergent extension involved in gastrulation disrupted, abnormal	AB/TU + MO1-ptenb	standard conditions	Fig. 6 , Fig. 7 from Yeh et al., 2011
hypoblast cell projection physical object quality, abnormal	AB/TU + MO1-ptenb	standard conditions	Fig. 8 from Yeh et al., 2011
dorsal convergence disrupted, abnormal	AB/TU + MO1-ptenb	standard conditions	Fig. 5 , Fig. 7 from Yeh et al., 2011
post-vent region decreased length, abnormal	AB/TU + MO1-ptenb	standard conditions	Fig. 4 from Yeh et al., 2011
whole organism decreased length, abnormal	AB/TU + MO1-ptenb	standard conditions	Fig. 4 from Yeh et al., 2011
gastrulation disrupted, abnormal	AB/TU + MO1-ptenb	standard conditions	Fig. 4 from Yeh et al., 2011
actin filament polymerization increased occurrence, abnormal	AB/TU + MO1-ptenb	standard conditions	Fig. 10 from Yeh et al., 2011
blood decreased fluid flow, abnormal	WT + MO1-ptenb	standard conditions	Fig. 7 from Croushore et al., 2005
notochord undulate, abnormal	WT + MO1-ptenb	standard conditions	Fig. 7 from Croushore et al., 2005
extension decreased length, abnormal	WT + MO1-ptenb	standard conditions	Fig. 7 from Croushore et al., 2005
post-vent region curved dorsal, abnormal	WT + MO1-ptenb	standard conditions	Fig. 7 from Croushore et al., 2005
phosphatidylinositol dephosphorylation decreased occurrence, abnormal	WT + MO1-ptenb	standard conditions	Fig. 8 from Croushore et al., 2005
intersegmental vessel malformed, abnormal	WT + MO1-ptenb	standard conditions	Fig. 7 from Croushore et al., 2005
macrophage decreased amount, abnormal	WT + MO1-ptenb	standard conditions	Fig. 5 from Fu et al., 2010
head domed, abnormal	WT + MO1-ptenb	standard conditions	Fig. 7 from Croushore et al., 2005
caudal fin falciform, abnormal	WT + MO1-ptenb	standard conditions	Fig. 7 from Croushore et al., 2005
lipid phosphatase activity disrupted, abnormal	WT + MO1-ptenb	standard conditions	Fig. 8 from Croushore et al., 2005
myeloid lineage restricted progenitor cell mislocalised, abnormal	zdf11Tg + MO1-ptenb	standard conditions	Fig. 5 from Fu et al., 2010

Citations