Morpholino

MO1-bbs1

ID
ZDB-MRPHLNO-060208-2
Name
MO1-bbs1
Previous Names
None
Target
Sequence
5' - GGCTGGCAAATAAGCTGTCCACAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bbs1
Expressed Gene Anatomy Figures
axin2 Fig. 2 from Gerdes et al., 2007
c3a.2 Fig. 7 from Hostelley et al., 2016
cela1.6 Fig. 7,  Fig. S3 from Hostelley et al., 2016
chrd Fig. 5,  Fig. S3 from Gerdes et al., 2007
ctrb.1 Fig. S3 from Hostelley et al., 2016
ctrl Fig. S3 from Hostelley et al., 2016
egr2b Fig. 1 from Gerdes et al., 2007
gcga Fig. 2 from Lodh et al., 2016
gvin1l Fig. 7 from Hostelley et al., 2016
isl1a Fig. 2 from Lodh et al., 2016
myod1 Fig. 1 from Gerdes et al., 2007
neurod1 Fig. 2 from Lodh et al., 2016
pax2a Fig. 1 from Gerdes et al., 2007
pdx1 Fig. 2 from Lodh et al., 2016
prss1 Fig. S3 from Hostelley et al., 2016
prss59.1 Fig. 7,  Fig. S3 from Hostelley et al., 2016
smc1b Fig. 7 from Hostelley et al., 2016
snord31.1 Fig. 7 from Hostelley et al., 2016
snord31.2 Fig. 7 from Hostelley et al., 2016
sp5l Fig. 2 from Gerdes et al., 2007
sst1.1 Fig. 2 from Lodh et al., 2016
vtg7 Fig. 7 from Hostelley et al., 2016
Phenotype
Phenotype resulting from MO1-bbs1
Phenotype Fish Figures
cell migration involved in gastrulation disrupted, abnormal WT + MO1-bbs1 Fig. S3 with image from Zaghloul et al., 2010
convergent extension process quality, abnormal WT + MO1-bbs1 Fig. 5 from Lindstrand et al., 2014
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-bbs1 Fig. 1 from Gerdes et al., 2007
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-bbs1 Fig. 2 from Gerdes et al., 2007
exocrine pancreas decreased area, abnormal jh1Tg; jh2Tg + MO1-bbs1 Fig. S1 from Lodh et al., 2016
eye decreased size, abnormal WT + MO1-bbs1 Fig. 2 from Putoux et al., 2011
gastrulation disrupted, abnormal WT + MO1-bbs1 Fig. S4 with image from Zaghloul et al., 2010
head decreased size, abnormal WT + MO1-bbs1 Fig. 2 from Putoux et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal TU + MO1-bbs1 Figure S1 from Castro-Sánchez et al., 2019
Kupffer's vesicle cilium decreased length, abnormal TU + MO1-bbs1 Figure 5 with image from Castro-Sánchez et al., 2019
Kupffer's vesicle cilium spatial pattern, abnormal TU + MO1-bbs1 Figure 5 with image from Castro-Sánchez et al., 2019
notochord increased width, abnormal TU + MO1-bbs1 Figure 4 with image from Castro-Sánchez et al., 2019
Fig. 5 from Lindstrand et al., 2014
Fig. 4 with image from Zaghloul et al., 2010
Fig. 1 from Gerdes et al., 2007
Fig. 4 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
notochord kinked, abnormal WT + MO1-bbs1 Figure 4 with image from Castro-Sánchez et al., 2019
Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. 4 with image,  Fig. S4 with image from Zaghloul et al., 2010
Fig. 1 from Gerdes et al., 2007
Fig. 4 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
pancreatic A cell gcga expression decreased amount, abnormal TU + MO1-bbs1 Fig. 2 from Lodh et al., 2016
pancreatic B cell mCherry expression increased amount, abnormal jh2Tg + MO1-bbs1 Fig. 1 from Lodh et al., 2016
pancreatic B cell increased amount, abnormal WT + MO1-bbs1 Fig. 1. with image from Hostelley et al., 2021
Fig. 1 from Lodh et al., 2016
pancreatic B cell increased area, abnormal jh2Tg + MO1-bbs1 Fig. 1 from Lodh et al., 2016
pancreatic bud isl1a expression decreased amount, abnormal TU + MO1-bbs1 Fig. 2 from Lodh et al., 2016
pancreatic bud neurod1 expression decreased amount, abnormal TU + MO1-bbs1 Fig. 2 from Lodh et al., 2016
pancreatic bud pdx1 expression decreased amount, abnormal TU + MO1-bbs1 Fig. 2 from Lodh et al., 2016
pancreatic D cell sst1.1 expression decreased amount, abnormal TU + MO1-bbs1 Fig. 2 from Lodh et al., 2016
pronephric proximal convoluted tubule morphology, abnormal WT + MO1-bbs1 Fig. 5 from Lindstrand et al., 2014
pronephros development disrupted, abnormal WT + MO1-bbs1 Fig. 5 from Lindstrand et al., 2014
somite amorphous, abnormal WT + MO1-bbs1 Fig. 2 from Stoetzel et al., 2006
somite increased length, abnormal WT + MO1-bbs1 Fig. 1 from Gerdes et al., 2007
Fig. 2 from Stoetzel et al., 2006
somite increased width, abnormal WT + MO1-bbs1 Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. 4 with image,  Fig. S4 with image from Zaghloul et al., 2010
Fig. 4 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
somite morphology, abnormal TU + MO1-bbs1 Figure 4 with image from Castro-Sánchez et al., 2019
somite shape, abnormal WT + MO1-bbs1 Fig. 2 from Putoux et al., 2011
Fig. 1 from Gerdes et al., 2007
Fig. 4 from Badano et al., 2006
whole organism smc1b expression decreased amount, abnormal TU + MO1-bbs1 Fig. 7 from Hostelley et al., 2016
whole organism decreased length, abnormal WT + MO1-bbs1 Fig. 1 from Gerdes et al., 2007
whole organism snord31.1 expression increased amount, abnormal TU + MO1-bbs1 Fig. 7 from Hostelley et al., 2016
whole organism ctrl expression increased amount, abnormal TU + MO1-bbs1 Fig. S3 from Hostelley et al., 2016
whole organism ctrb.1 expression increased amount, abnormal TU + MO1-bbs1 Fig. S3 from Hostelley et al., 2016
whole organism gvin1l expression increased amount, abnormal TU + MO1-bbs1 Fig. 7 from Hostelley et al., 2016
whole organism vtg7 expression increased amount, abnormal TU + MO1-bbs1 Fig. 7 from Hostelley et al., 2016
whole organism cela1.6 expression increased amount, abnormal TU + MO1-bbs1 Fig. 7,  Fig. S3 from Hostelley et al., 2016
whole organism c3a.2 expression increased amount, abnormal TU + MO1-bbs1 Fig. 7 from Hostelley et al., 2016
whole organism prss1 expression increased amount, abnormal TU + MO1-bbs1 Fig. S3 from Hostelley et al., 2016
whole organism prss59.1 expression increased amount, abnormal TU + MO1-bbs1 Fig. 7,  Fig. S3 from Hostelley et al., 2016
whole organism snord31.2 expression increased amount, abnormal TU + MO1-bbs1 Fig. 7 from Hostelley et al., 2016
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs1 Figure 4 with image from Castro-Sánchez et al., 2019
Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. 4 with image,  Fig. S4 with image from Zaghloul et al., 2010
Fig. 4 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
Phenotype of all Fish created by or utilizing MO1-bbs1
Phenotype Fish Conditions Figures
whole organism snord31.1 expression increased amount, abnormal TU + MO1-bbs1 standard conditions Fig. 7 from Hostelley et al., 2016
pancreatic A cell gcga expression decreased amount, abnormal TU + MO1-bbs1 standard conditions Fig. 2 from Lodh et al., 2016
whole organism vtg7 expression increased amount, abnormal TU + MO1-bbs1 standard conditions Fig. 7 from Hostelley et al., 2016
whole organism ctrl expression increased amount, abnormal TU + MO1-bbs1 standard conditions Fig. S3 from Hostelley et al., 2016
whole organism cela1.6 expression increased amount, abnormal TU + MO1-bbs1 standard conditions Fig. 7,  Fig. S3 from Hostelley et al., 2016
whole organism c3a.2 expression increased amount, abnormal TU + MO1-bbs1 standard conditions Fig. 7 from Hostelley et al., 2016
Kupffer's vesicle cilium decreased length, abnormal TU + MO1-bbs1 standard conditions Figure 5 with image from Castro-Sánchez et al., 2019
whole organism prss59.1 expression increased amount, abnormal TU + MO1-bbs1 standard conditions Fig. 7,  Fig. S3 from Hostelley et al., 2016
pancreatic bud neurod1 expression decreased amount, abnormal TU + MO1-bbs1 standard conditions Fig. 2 from Lodh et al., 2016
pancreatic D cell sst1.1 expression decreased amount, abnormal TU + MO1-bbs1 standard conditions Fig. 2 from Lodh et al., 2016
whole organism prss1 expression increased amount, abnormal TU + MO1-bbs1 standard conditions Fig. S3 from Hostelley et al., 2016
notochord increased width, abnormal TU + MO1-bbs1 standard conditions Figure 4 with image from Castro-Sánchez et al., 2019
whole organism snord31.2 expression increased amount, abnormal TU + MO1-bbs1 standard conditions Fig. 7 from Hostelley et al., 2016
whole organism gvin1l expression increased amount, abnormal TU + MO1-bbs1 standard conditions Fig. 7 from Hostelley et al., 2016
pancreatic bud isl1a expression decreased amount, abnormal TU + MO1-bbs1 standard conditions Fig. 2 from Lodh et al., 2016
notochord kinked, abnormal TU + MO1-bbs1 standard conditions Figure 4 with image from Castro-Sánchez et al., 2019
whole organism anterior-posterior axis decreased length, abnormal TU + MO1-bbs1 standard conditions Figure 4 with image from Castro-Sánchez et al., 2019
pancreatic bud pdx1 expression decreased amount, abnormal TU + MO1-bbs1 standard conditions Fig. 2 from Lodh et al., 2016
somite morphology, abnormal TU + MO1-bbs1 standard conditions Figure 4 with image from Castro-Sánchez et al., 2019
Kupffer's vesicle cilium spatial pattern, abnormal TU + MO1-bbs1 standard conditions Figure 5 with image from Castro-Sánchez et al., 2019
whole organism ctrb.1 expression increased amount, abnormal TU + MO1-bbs1 standard conditions Fig. S3 from Hostelley et al., 2016
Kupffer's vesicle cilium decreased amount, abnormal TU + MO1-bbs1 standard conditions Figure S1 from Castro-Sánchez et al., 2019
whole organism smc1b expression decreased amount, abnormal TU + MO1-bbs1 standard conditions Fig. 7 from Hostelley et al., 2016
cell migration involved in gastrulation disrupted, abnormal WT + MO1-bbs1 standard conditions Fig. S3 with image from Zaghloul et al., 2010
whole organism decreased length, abnormal WT + MO1-bbs1 standard conditions Fig. 1 from Gerdes et al., 2007
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs1 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. 4 with image,  Fig. S4 with image from Zaghloul et al., 2010
Fig. 4 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
notochord increased width, abnormal WT + MO1-bbs1 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 4 with image from Zaghloul et al., 2010
Fig. 1 from Gerdes et al., 2007
Fig. 4 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
somite amorphous, abnormal WT + MO1-bbs1 standard conditions Fig. 2 from Stoetzel et al., 2006
convergent extension process quality, abnormal WT + MO1-bbs1 standard conditions Fig. 5 from Lindstrand et al., 2014
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-bbs1 standard conditions Fig. 1 from Gerdes et al., 2007
pronephric proximal convoluted tubule morphology, abnormal WT + MO1-bbs1 standard conditions Fig. 5 from Lindstrand et al., 2014
somite increased width, abnormal WT + MO1-bbs1 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. 4 with image,  Fig. S4 with image from Zaghloul et al., 2010
Fig. 4 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
gastrulation disrupted, abnormal WT + MO1-bbs1 standard conditions Fig. S4 with image from Zaghloul et al., 2010
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-bbs1 standard conditions Fig. 2 from Gerdes et al., 2007
pancreatic B cell increased amount, abnormal WT + MO1-bbs1 standard conditions Fig. 1. with image from Hostelley et al., 2021
eye decreased size, abnormal WT + MO1-bbs1 standard conditions Fig. 2 from Putoux et al., 2011
somite shape, abnormal WT + MO1-bbs1 standard conditions Fig. 2 from Putoux et al., 2011
Fig. 1 from Gerdes et al., 2007
Fig. 4 from Badano et al., 2006
somite increased length, abnormal WT + MO1-bbs1 standard conditions Fig. 1 from Gerdes et al., 2007
Fig. 2 from Stoetzel et al., 2006
head decreased size, abnormal WT + MO1-bbs1 standard conditions Fig. 2 from Putoux et al., 2011
notochord kinked, abnormal WT + MO1-bbs1 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. 4 with image,  Fig. S4 with image from Zaghloul et al., 2010
Fig. 1 from Gerdes et al., 2007
Fig. 4 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
pronephros development disrupted, abnormal WT + MO1-bbs1 standard conditions Fig. 5 from Lindstrand et al., 2014
pancreatic B cell proliferative, abnormal jh2Tg + MO1-bbs1 chemical treatment: D-glucopyranose Fig. 4 from Lodh et al., 2016
pancreatic B cell increased area, abnormal jh2Tg + MO1-bbs1 standard conditions Fig. 1 from Lodh et al., 2016
apoptotic process increased occurrence, abnormal jh2Tg + MO1-bbs1 chemical treatment: D-glucopyranose Fig. 5 from Lodh et al., 2016
pancreatic B cell apoptotic, abnormal jh2Tg + MO1-bbs1 chemical treatment: D-glucopyranose Fig. 5 from Lodh et al., 2016
pancreatic B cell increased amount, abnormal jh2Tg + MO1-bbs1 standard conditions Fig. 1 from Lodh et al., 2016
pancreatic B cell cell population proliferation increased occurrence, abnormal jh2Tg + MO1-bbs1 chemical treatment: D-glucopyranose Fig. 4 from Lodh et al., 2016
pancreatic B cell mCherry expression increased amount, abnormal jh2Tg + MO1-bbs1 standard conditions Fig. 1 from Lodh et al., 2016
exocrine pancreas decreased area, abnormal jh1Tg; jh2Tg + MO1-bbs1 standard conditions Fig. S1 from Lodh et al., 2016
somite increased length, abnormal wnt5bta98/+ + MO1-bbs1 standard conditions Fig. 1 from Gerdes et al., 2007
convergent extension involved in axis elongation disrupted, abnormal wnt5bta98/+ + MO1-bbs1 standard conditions Fig. 1 from Gerdes et al., 2007
somite shape, abnormal wnt5bta98/+ + MO1-bbs1 standard conditions Fig. 1 from Gerdes et al., 2007
whole organism decreased length, abnormal wnt5bta98/+ + MO1-bbs1 standard conditions Fig. 1 from Gerdes et al., 2007
notochord increased width, abnormal wnt5bta98/+ + MO1-bbs1 standard conditions Fig. 1 from Gerdes et al., 2007
notochord kinked, abnormal wnt5bta98/+ + MO1-bbs1 standard conditions Fig. 1 from Gerdes et al., 2007
somite shape, abnormal wnt11f2tx226/+ + MO1-bbs1 standard conditions Fig. 1 from Gerdes et al., 2007
somite increased length, abnormal wnt11f2tx226/+ + MO1-bbs1 standard conditions Fig. 1 from Gerdes et al., 2007
notochord kinked, abnormal wnt11f2tx226/+ + MO1-bbs1 standard conditions Fig. 1,  Fig. S2 from Gerdes et al., 2007
convergent extension involved in axis elongation disrupted, abnormal wnt11f2tx226/+ + MO1-bbs1 standard conditions Fig. 1 from Gerdes et al., 2007
whole organism decreased length, abnormal wnt11f2tx226/+ + MO1-bbs1 standard conditions Fig. 1 from Gerdes et al., 2007
notochord increased width, abnormal wnt11f2tx226/+ + MO1-bbs1 standard conditions Fig. 1 from Gerdes et al., 2007
gastrulation disrupted, abnormal wnt11f2tx226/+ + MO1-bbs1 standard conditions Fig. S2 from Gerdes et al., 2007
somite increased width, abnormal wnt11f2tx226/+ + MO1-bbs1 standard conditions Fig. S2 from Gerdes et al., 2007
notochord increased width, abnormal WT + MO1-bbs1 + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
somite amorphous, abnormal WT + MO1-bbs1 + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs1 + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
somite increased length, abnormal WT + MO1-bbs1 + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
somite increased width, abnormal WT + MO1-bbs1 + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
notochord kinked, abnormal WT + MO1-bbs1 + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
notochord increased width, abnormal WT + MO1-bbs1 + MO1-ccdc28b standard conditions Fig. 4 from Badano et al., 2006
somite shape, abnormal WT + MO1-bbs1 + MO1-ccdc28b standard conditions Fig. 4 from Badano et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs1 + MO1-ccdc28b standard conditions Fig. 4 from Badano et al., 2006
somite increased width, abnormal WT + MO1-bbs1 + MO1-ccdc28b standard conditions Fig. 4 from Badano et al., 2006
notochord kinked, abnormal WT + MO1-bbs1 + MO1-ccdc28b standard conditions Fig. 4 from Badano et al., 2006
somite border amorphous, abnormal WT + MO1-bbs1 + MO1-ccdc28b standard conditions Fig. 4 from Badano et al., 2006
eye decreased size, abnormal WT + MO1-bbs1 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
head decreased size, abnormal WT + MO1-bbs1 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs1 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
somite shape, abnormal WT + MO1-bbs1 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
notochord kinked, abnormal WT + MO1-bbs1 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
somite increased width, abnormal WT + MO1-bbs1 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
notochord increased width, abnormal WT + MO1-bbs1 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
convergent extension process quality, abnormal WT + MO1-bbs1 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
somite increased width, abnormal WT + MO1-bbs1 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
pronephros development disrupted, abnormal WT + MO1-bbs1 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
notochord kinked, abnormal WT + MO1-bbs1 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs1 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
pronephric proximal convoluted tubule morphology, abnormal WT + MO1-bbs1 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
notochord increased width, abnormal WT + MO1-bbs1 + MO3-bbs2 standard conditions Fig. 4 with image from Zaghloul et al., 2010
whole organism lacks all parts of type optic vesicle, abnormal WT + MO1-bbs1 + MO3-bbs2 standard conditions Fig. 4 with image from Zaghloul et al., 2010
somite increased width, abnormal WT + MO1-bbs1 + MO3-bbs2 standard conditions Fig. 4 with image from Zaghloul et al., 2010
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs1 + MO3-bbs2 standard conditions Fig. 4 with image from Zaghloul et al., 2010
somite amorphous, abnormal WT + MO1-bbs1 + MO3-bbs2 standard conditions Fig. 4 with image from Zaghloul et al., 2010
notochord kinked, abnormal WT + MO1-bbs1 + MO3-bbs2 standard conditions Fig. 4 with image from Zaghloul et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.