header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060207-1
Morpholino Name: MO4-runx1
Target: runx1 (1)
Previous Name: runx1-MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGGCGTCCCAAAGAAAAACCATTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-runx1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-runx1
Expressed Gene Anatomy Figures
cebp1 Fig. 3 with image from Kitaguchi et al., 2009
lyz Fig. 3 with image from Kitaguchi et al., 2009
spi1b Fig. 3 with image from Kitaguchi et al., 2009
PHENOTYPE
Phenotype resulting from MO4-runx1
Phenotype of all Fish created by or utilizing MO4-runx1
OTHER MO4-runx1 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)