ZFIN ID: ZDB-MRPHLNO-060206-2
Morpholino Name: MO1-rab5c
Target: rab5c (1)
Previous Name: rab5c-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGCTGGTCCACCTCGCCCCGCCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rab5c No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rab5c
Expressed Gene Anatomy Figures
bmp4 Fig. S2 from Ulrich et al., 2005
ctslb Fig. 5 from Ulrich et al., 2005
dlx3b Fig. 5 from Ulrich et al., 2005
gsc Fig. S2 from Ulrich et al., 2005
noto Fig. S2 from Ulrich et al., 2005
tbxta Fig. 5Fig. S2 from Ulrich et al., 2005
PHENOTYPE
Phenotype resulting from MO1-rab5c
Phenotype of all Fish created by or utilizing MO1-rab5c
Phenotype Fish Conditions Figures
DEL increased thickness, abnormal AB/TL + MO1-rab5c standard conditions Fig. 3 with image from Song et al., 2013
epiboly delayed, abnormal AB/TL + MO1-rab5c standard conditions Fig. 3 with image from Song et al., 2013
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
skeletal muscle disorganized, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
somite U-shaped, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
head decreased size, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
notochord cell malformed, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
forebrain morphology, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
brain necrotic, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
caudal fin curved, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
forebrain morphology, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
head hypoplastic, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
whole organism anterior-posterior axis curved, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
somite U-shaped, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
brain necrotic, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
skeletal muscle disorganized, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
Genome Resources:
CITATIONS (3)