Morpholino
MO1-lama4
- ID
- ZDB-MRPHLNO-060119-6
- Name
- MO1-lama4
- Previous Names
-
- lama4 MO1 (1)
- Target
- Sequence
-
5' - GCCATGATTCCCCCTGCAACAACTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lama4
No data available
Phenotype
Phenotype resulting from MO1-lama4
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-lama4
1 - 5 of 21 Show all
Citations
- Sztal, T.E., Sonntag, C., Hall, T.E., and Currie, P.D. (2012) Epistatic dissection of laminin-receptor interactions in dystrophic zebrafish muscle. Human molecular genetics. 21(21):4718-4731
- Postel, R., Vakeel, P., Topczewski, J., Knöll, R., and Bakkers, J. (2008) Zebrafish integrin-linked kinase is required in skeletal muscles for strengthening the integrin-ECM adhesion complex. Developmental Biology. 318(1):92-101
- Knöll, R., Postel, R., Wang, J., Krätzner, R., Hennecke, G., Vacaru, A.M., Vakeel, P., Schubert, C., Murthy, K., Rana, B.K., Kube, D., Knöll, G., Schäfer, K., Hayashi, T., Holm, T., Kimura, A., Schork, N., Toliat, M.R., Nürnberg, P., Schultheiss, H.P., Schaper, W., Schaper, J., Bos, E., den Hertog, J., van Eeden, F.J., Peters, P.J., Hasenfuss, G., Chien, K.R., and Bakkers, J. (2007) Laminin-alpha4 and integrin-linked kinase mutations cause human cardiomyopathy via simultaneous defects in cardiomyocytes and endothelial cells. Circulation. 116(5):515-525
- Pollard, S.M., Parsons, M.J., Kamei, M., Kettleborough, R.N., Thomas, K.A., Pham, V.N., Bae, M.K., Scott, A., Weinstein, B.M., and Stemple, D.L. (2006) Essential and overlapping roles for laminin alpha chains in notochord and blood vessel formation. Developmental Biology. 289(1):64-76
1 - 4 of 4
Show