header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060111-5
Morpholino Name: MO3-tbx16
Target: tbx16 (1)
Sequence:
5' - GCTTGAGGTCTCTGATAGCCTGCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-tbx16 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-tbx16
Expressed Gene Anatomy Figures
cp Fig. 5 with image from Nelson et al., 2017
foxa3 Fig. 5 with image from Nelson et al., 2017
ins Fig. 5 with image from Nelson et al., 2017
lft1 Fig. 5 with image from Amack et al., 2007
lft2 Fig. 5 with image from Amack et al., 2007
mixl1 Fig. 4 with image from Nelson et al., 2017
myod1 Fig. S3 with image from Amack et al., 2007
sdc2 Fig. S2 with image from Arrington et al., 2013
shha Fig. 5 with imageFig. S3 with image from Amack et al., 2007
sox17 Fig. 4 with image from Nelson et al., 2017
text only from Amack et al., 2007
sox32 Fig. 4 with image from Nelson et al., 2017
spaw Fig. 5 with image from Amack et al., 2007
tbx16 Fig. 4 with imageFig. 6 with image from Amack et al., 2007
tbxta Fig. 6 with image from Amack et al., 2007
PHENOTYPE
Phenotype resulting from MO3-tbx16
Phenotype Figures
determination of digestive tract left/right asymmetry decreased occurrence, abnormal Fig. 5 with image from Nelson et al., 2017
determination of left/right symmetry disrupted, abnormal Fig. 5 with image from Amack et al., 2007
determination of liver left/right asymmetry decreased occurrence, abnormal Fig. 5 with image from Nelson et al., 2017
determination of pancreatic left/right asymmetry decreased occurrence, abnormal Fig. 5 with image from Nelson et al., 2017
diencephalon mislocalised, abnormal Fig. 5 with image from Amack et al., 2007
digestive system foxa3 expression spatial pattern, abnormal Fig. 5 with image from Nelson et al., 2017
digestive tract development process quality, abnormal Fig. 5 with image from Nelson et al., 2017
endoderm sox17 expression decreased amount, abnormal Fig. 4 with image from Nelson et al., 2017
endoderm EGFP expression decreased amount, abnormal Fig. 4 with image from Nelson et al., 2017
endoderm EGFP expression spatial pattern, abnormal Fig. 5 with image from Nelson et al., 2017
endodermal cell decreased amount, abnormal Fig. 4 with image from Nelson et al., 2017
gut malformed, abnormal Fig. 5 with image from Nelson et al., 2017
heart rudiment mislocalised, abnormal Fig. 5 with image from Amack et al., 2007
Kupffer's vesicle decreased size, abnormal Fig. 5 with imageFig. 7 with image from Amack et al., 2007
Kupffer's vesicle malformed, abnormal Fig. 5 with imageFig. 7 with image from Amack et al., 2007
liver cp expression decreased amount, abnormal Fig. 5 with image from Nelson et al., 2017
liver position, abnormal Fig. 5 with image from Nelson et al., 2017
liver cp expression spatial pattern, abnormal Fig. 5 with image from Nelson et al., 2017
liver development decreased occurrence, abnormal Fig. 5 with image from Nelson et al., 2017
liver development process quality, abnormal Fig. 5 with image from Nelson et al., 2017
notochord kinked, abnormal Fig. 5 with image from Amack et al., 2007
pancreas ins expression decreased amount, abnormal Fig. 5 with image from Nelson et al., 2017
pancreas position, abnormal Fig. 5 with image from Nelson et al., 2017
pancreas ins expression spatial pattern, abnormal Fig. 5 with image from Nelson et al., 2017
pancreas development decreased occurrence, abnormal Fig. 5 with image from Nelson et al., 2017
pancreas development process quality, abnormal Fig. 5 with image from Nelson et al., 2017
post-vent region shape, abnormal Fig. 5 with imageFig. 8 with image from Amack et al., 2007
presumptive endoderm sox32 expression decreased amount, abnormal Fig. 4 with image from Nelson et al., 2017
trunk morphology, abnormal Fig. 5 with imageFig. 8 with image from Amack et al., 2007
whole organism sox32 expression decreased amount, abnormal Fig. 4 with image from Nelson et al., 2017
whole organism mixl1 expression decreased amount, abnormal Fig. 4 with image from Nelson et al., 2017

Phenotype of all Fish created by or utilizing MO3-tbx16
Phenotype Fish Conditions Figures
trunk morphology, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with imageFig. 8 with image from Amack et al., 2007
liver development decreased occurrence, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
Kupffer's vesicle malformed, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with imageFig. 7 with image from Amack et al., 2007
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
determination of left/right symmetry disrupted, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Amack et al., 2007
determination of pancreatic left/right asymmetry decreased occurrence, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
pancreas development decreased occurrence, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
notochord kinked, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Amack et al., 2007
pancreas development process quality, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
digestive system foxa3 expression spatial pattern, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
pancreas ins expression spatial pattern, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
determination of digestive tract left/right asymmetry decreased occurrence, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
pancreas position, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
diencephalon mislocalised, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Amack et al., 2007
liver position, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
whole organism sox32 expression decreased amount, abnormal AB + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
pancreas ins expression decreased amount, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
Kupffer's vesicle decreased size, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with imageFig. 7 with image from Amack et al., 2007
liver cp expression decreased amount, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
heart rudiment mislocalised, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Amack et al., 2007
digestive tract development process quality, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
whole organism mixl1 expression decreased amount, abnormal AB + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
liver cp expression spatial pattern, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
post-vent region shape, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with imageFig. 8 with image from Amack et al., 2007
endoderm sox17 expression decreased amount, abnormal AB + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
liver development process quality, abnormal AB + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
presumptive endoderm sox32 expression decreased amount, abnormal AB + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
endodermal cell decreased amount, abnormal AB + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
gut malformed, abnormal ha01Tg + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
endoderm EGFP expression spatial pattern, abnormal ha01Tg + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
digestive tract development process quality, abnormal ha01Tg + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
endoderm EGFP expression decreased amount, abnormal ha01Tg + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
determination of left/right asymmetry in lateral mesoderm process quality, abnormal AB + MO1-fgf2 + MO3-tbx16 standard conditions Fig. 5 with image from Arrington et al., 2013
post-vent region shape, abnormal AB + MO1-tbxta + MO3-tbx16 standard conditions Fig. 8 with image from Amack et al., 2007
Kupffer's vesicle ciliated cell absent, abnormal AB + MO1-tbxta + MO3-tbx16 standard conditions Fig. 8 with image from Amack et al., 2007
trunk morphology, abnormal AB + MO1-tbxta + MO3-tbx16 standard conditions Fig. 8 with image from Amack et al., 2007
pancreas development decreased occurrence, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
whole organism sox32 expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
whole organism mixl1 expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
determination of digestive tract left/right asymmetry decreased occurrence, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
liver cp expression absent, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
anatomical structure cxcl12b expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
pancreas ins expression absent, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
liver development decreased occurrence, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
digestive tract development process quality, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
endoderm sox17 expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
whole organism gata5 expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
endodermal cell decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
presumptive endoderm sox32 expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
digestive system foxa3 expression spatial pattern, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
anatomical structure cxcl12a expression decreased amount, abnormal AB + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
determination of left/right asymmetry in lateral mesoderm process quality, abnormal AB + MO3-tbx16 + MO5-sdc2 standard conditions Fig. 5 with image from Arrington et al., 2013
gut malformed, abnormal ha01Tg + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
endoderm EGFP expression spatial pattern, abnormal ha01Tg + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
digestive tract development process quality, abnormal ha01Tg + MO2-tbxta + MO3-tbx16 standard conditions Fig. 5 with image from Nelson et al., 2017
endoderm EGFP expression decreased amount, abnormal ha01Tg + MO2-tbxta + MO3-tbx16 standard conditions Fig. 4 with image from Nelson et al., 2017
OTHER MO3-tbx16 MORPHOLINO PAGESNo links to external sites
CITATIONS (11)