Morpholino
MO1-six3a,six3b
- ID
- ZDB-MRPHLNO-051220-2
- Name
- MO1-six3a,six3b
- Previous Names
-
- six3-AMO
- Targets
- Sequence
-
5' - GCTCTAAAGGAGACCTGAAAACCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The authors state that this morpholino is also effective at reducing translation of six3a, to which it has a 2-bp mismatch.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-six3a,six3b
No data available
Phenotype
Phenotype resulting from MO1-six3a,six3b
No data available
Phenotype of all Fish created by or utilizing MO1-six3a,six3b
1 - 5 of 8 Show all
Citations
- Bengani, H., Grozeva, D., Moyon, L., Bhatia, S., Louros, S.R., Hope, J., Jackson, A., Prendergast, J.G., Owen, L.J., Naville, M., Rainger, J., Grimes, G., Halachev, M., Murphy, L.C., Spasic-Boskovic, O., van Heyningen, V., Kind, P., Abbott, C.M., Osterweil, E., Raymond, F.L., Roest Crollius, H., FitzPatrick, D.R. (2021) Identification and functional modelling of plausibly causative cis-regulatory variants in a highly-selected cohort with X-linked intellectual disability. PLoS One. 16:e0256181
- Ando, H., Sato, T., Ito, T., Yamamoto, J., Sakamoto, S., Nitta, N., Asatsuma-Okumura, T., Shimizu, N., Mizushima, R., Aoki, I., Imai, T., Yamaguchi, Y., Berk, A.J., Handa, H. (2019) Cereblon Control of Zebrafish Brain Size by Regulation of Neural Stem Cell Proliferation. iScience. 15:95-108
- Bhatia, S., Gordon, C.T., Foster, R.G., Melin, L., Abadie, V., Baujat, G., Vazquez, M.P., Amiel, J., Lyonnet, S., Heyningen, V.V., Kleinjan, D.A. (2015) Functional Assessment of Disease-Associated Regulatory Variants In Vivo Using a Versatile Dual Colour Transgenesis Strategy in Zebrafish. PLoS Genetics. 11:e1005193
- Lenkowski, J.R., Qin, Z., Sifuentes, C.J., Thummel, R., Soto, C.M., Moens, C.B., Raymond, P.A.. (2013) Retinal regeneration in adult zebrafish requires regulation of TGFβ signaling. Glia. 61(10):1687-1697
- Ando, H., Kobayashi, M., Tsubokawa, T., Uyemura, K., Furuta, T., and Okamoto, H. (2005) Lhx2 mediates the activity of Six3 in zebrafish forebrain growth. Developmental Biology. 287(2):456-468
1 - 5 of 5
Show