header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-051220-2
Morpholino Name: MO1-six3a,six3b
Targets: six3a , six3b
Previous Name: six3-AMO

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCTCTAAAGGAGACCTGAAAACCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The authors state that this morpholino is also effective at reducing translation of six3a, to which it has a 2-bp mismatch.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-six3a,six3b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-six3a,six3b
Expressed Gene Anatomy Figures
eomesa Fig. 5 with image from Ando et al., 2005
lhx2b Fig. 4 with image from Ando et al., 2005
myod1 Fig. 4 with image from Ando et al., 2005
pax2a Fig. 4 with imageFig. 5 with image from Ando et al., 2005
PHENOTYPE
Phenotype resulting from MO1-six3a,six3b
No data available

Phenotype of all Fish created by or utilizing MO1-six3a,six3b
Genome Resources: MODB:110 (2)
CITATIONS (6)