Morpholino

MO3-vegfaa

ID
ZDB-MRPHLNO-051212-1
Name
MO3-vegfaa
Previous Names
  • MO3-vegf
  • MO3-vegfa
Target
Sequence
5' - CTCGTCTTATTTCCGTGACTGTTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-vegfaa
Phenotype
Phenotype resulting from MO3-vegfaa
Phenotype of all Fish created by or utilizing MO3-vegfaa
Phenotype Fish Conditions Figures
blood vessel morphogenesis disrupted, abnormal WT + MO3-vegfaa standard conditions Fig. 2 from Herbert et al., 2009
dorsal aorta aplastic, abnormal WT + MO3-vegfaa standard conditions Fig. 2 from Herbert et al., 2009
sprouting angiogenesis disrupted, abnormal WT + MO3-vegfaa standard conditions Fig. 2 from Herbert et al., 2009
intersegmental vessel aplastic, abnormal WT + MO3-vegfaa standard conditions Fig. 2 from Herbert et al., 2009
angiogenesis disrupted, abnormal y1Tg + MO3-vegfaa standard conditions Fig. 3 from Pan et al., 2012
positive regulation of ERK1 and ERK2 cascade decreased magnitude, abnormal y1Tg + MO3-vegfaa standard conditions Fig. 3Fig. 4 from Pan et al., 2012
blood vessel endothelial cell decreased amount, abnormal y1Tg + MO3-vegfaa standard conditions Fig. 3 from Pan et al., 2012
intersegmental vessel decreased length, abnormal y1Tg + MO3-vegfaa standard conditions Fig. 3 from Pan et al., 2012
positive regulation of vascular endothelial growth factor signaling pathway decreased occurrence, abnormal y1Tg + MO3-vegfaa standard conditions Fig. 3Fig. 4 from Pan et al., 2012
cardioblast migration to the midline involved in heart field formation decreased process quality, abnormal s896Tg; twu26Tg + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
endocardium mislocalised, abnormal s896Tg; twu26Tg + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
myocardium mislocalised, abnormal s896Tg; twu26Tg + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
embryonic heart tube morphogenesis decreased process quality, abnormal s896Tg; twu26Tg + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
endocardium mislocalised, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
embryonic heart tube morphogenesis decreased process quality, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
cardioblast migration to the midline involved in heart field formation decreased process quality, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
myocardium mislocalised, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
Citations