header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-051212-1
Morpholino Name: MO3-vegfaa
Target: vegfaa (1)
Previous Names: MO3-vegf, MO3-vegfa

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTCGTCTTATTTCCGTGACTGTTTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-vegfaa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-vegfaa
Expressed Gene Anatomy Figures
cdh5 Fig. 6 with image from Jin et al., 2005
dll4 Fig. 3 from Pan et al., 2012
flt4 Fig. 3 from Pan et al., 2012
PHENOTYPE
Phenotype resulting from MO3-vegfaa
Phenotype of all Fish created by or utilizing MO3-vegfaa
Phenotype Fish Conditions Figures
blood vessel morphogenesis disrupted, abnormal WT + MO3-vegfaa standard conditions Fig. 2 from Herbert et al., 2009
dorsal aorta aplastic, abnormal WT + MO3-vegfaa standard conditions Fig. 2 from Herbert et al., 2009
sprouting angiogenesis disrupted, abnormal WT + MO3-vegfaa standard conditions Fig. 2 from Herbert et al., 2009
intersegmental vessel aplastic, abnormal WT + MO3-vegfaa standard conditions Fig. 2 from Herbert et al., 2009
angiogenesis disrupted, abnormal y1Tg + MO3-vegfaa standard conditions Fig. 3 from Pan et al., 2012
positive regulation of ERK1 and ERK2 cascade decreased magnitude, abnormal y1Tg + MO3-vegfaa standard conditions Fig. 3Fig. 4 from Pan et al., 2012
blood vessel endothelial cell decreased amount, abnormal y1Tg + MO3-vegfaa standard conditions Fig. 3 from Pan et al., 2012
positive regulation of vascular endothelial growth factor signaling pathway decreased occurrence, abnormal y1Tg + MO3-vegfaa standard conditions Fig. 3Fig. 4 from Pan et al., 2012
intersegmental vessel decreased length, abnormal y1Tg + MO3-vegfaa standard conditions Fig. 3 from Pan et al., 2012
cardioblast migration to the midline involved in heart field formation decreased process quality, abnormal s896Tg; twu26Tg + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
endocardium mislocalised, abnormal s896Tg; twu26Tg + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
myocardium mislocalised, abnormal s896Tg; twu26Tg + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
embryonic heart tube morphogenesis decreased process quality, abnormal s896Tg; twu26Tg + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
endocardium mislocalised, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
embryonic heart tube morphogenesis decreased process quality, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
cardioblast migration to the midline involved in heart field formation decreased process quality, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
myocardium mislocalised, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
OTHER MO3-vegfaa MORPHOLINO PAGESNo links to external sites
CITATIONS (9)