Morpholino

MO2-fzd2

ID
ZDB-MRPHLNO-051207-2
Name
MO2-fzd2
Previous Names
  • fz2 MO-1 (1)
Target
Sequence
5' - CCTGCATTGTCTCGAAAAGTTCCGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-fzd2
Expressed Gene Anatomy Figures
myod1 Fig. 2 from Sumanas et al., 2001
tbxta Fig. 2 from Sumanas et al., 2001
Phenotype
Phenotype resulting from MO2-fzd2
Phenotype Fish Figures
notochord decreased length, abnormal WT + MO2-fzd2 Fig. 2 from Sumanas et al., 2001
notochord increased thickness, abnormal WT + MO2-fzd2 Fig. 2 from Sumanas et al., 2001
notochord undulate, abnormal WT + MO2-fzd2 Fig. 2 from Sumanas et al., 2001
somite condensed, abnormal WT + MO2-fzd2 Fig. 2 from Sumanas et al., 2001
somite increased width, abnormal WT + MO2-fzd2 Fig. 2 from Sumanas et al., 2001
Phenotype of all Fish created by or utilizing MO2-fzd2
Phenotype Fish Conditions Figures
notochord undulate, abnormal WT + MO2-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
notochord increased thickness, abnormal WT + MO2-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
somite increased width, abnormal WT + MO2-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
notochord decreased length, abnormal WT + MO2-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
somite condensed, abnormal WT + MO2-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
post-vent region decreased length, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
floor plate undulate, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
Fig. 2 from Sumanas et al., 2001
post-vent region curved ventral, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
post-vent region kinked, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
endocrine pancreas development disrupted, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 with image,  Fig. 5 with image,  Fig. 6 with image from Kim et al., 2005
ventral fin fold decreased size, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
cell migration disrupted, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 with image,  Fig. 5 with image from Kim et al., 2005
notochord undulate, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
somite increased width, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
Kupffer's vesicle cilium decreased length, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
pancreas development disrupted, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 6 with image from Kim et al., 2005
dorsal fin decreased size, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
whole organism oblong, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
notochord decreased length, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
heart tube inverted, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
Kupffer's vesicle cilium decreased amount, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
notochord increased width, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
heart looping disrupted, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
hypochord undulate, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
Fig. 2 from Sumanas et al., 2001
somitogenesis disrupted, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
notochord kinked, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 2 from Sumanas et al., 2001
somite asymmetrical, abnormal WT + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 4 from Oishi et al., 2006
cell migration disrupted, abnormal zf5Tg + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 1 with image from Kim et al., 2005
endocrine pancreas development disrupted, abnormal zf5Tg + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 1 with image from Kim et al., 2005
convergent extension involved in gastrulation disrupted, abnormal wnt5bta98/ta98 + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
notochord increased width, abnormal wnt5bta98/ta98 + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
notochord decreased length, abnormal wnt5bta98/ta98 + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
notochord increased width, abnormal wnt11f2tx226/tx226 + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
notochord decreased length, abnormal wnt11f2tx226/tx226 + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
convergent extension involved in gastrulation disrupted, abnormal wnt11f2tx226/tx226 + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
notochord decreased length, abnormal WT + MO1-wnt5b + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-wnt5b + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.