Morpholino
MO2-sema3d
- ID
- ZDB-MRPHLNO-051128-3
- Name
- MO2-sema3d
- Previous Names
-
- 3DMO (1)
- Target
- Sequence
-
5' - CATGATGGACGAGGAGATTTCTGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sema3d
Expressed Gene | Anatomy | Figures |
---|---|---|
ccna2 |
Fig. 4 ![]() |
|
ccnd1 |
Fig. 4 ![]() |
|
cdh5 |
Fig. 6 ![]() |
|
cdkn1ca |
Fig. 4 ![]() |
|
crestin |
Fig. 1 ![]() ![]() |
|
dlx2a |
Fig. 2 ![]() |
|
efna5a |
Fig. 6
from Liu et al., 2004 |
|
efnb2a |
Fig. 6
from Liu et al., 2004 |
|
egr2b |
text only
from Berndt et al., 2006 |
|
foxd3 |
text only
from Berndt et al., 2006 Fig. 4 ![]() |
|
hoxa2b |
text only
from Berndt et al., 2006 |
|
hoxb1a |
text only
from Berndt et al., 2006 |
|
hoxb2a |
Fig. 1 ![]() |
|
hoxb3a |
text only
from Berndt et al., 2006 |
|
l1camb |
Fig. 3
from Wolman et al., 2007 |
|
myl7 |
Fig. 5 ![]() ![]() |
|
rag1 |
|
Fig. 2 ![]() |
snai1b |
text only
from Berndt et al., 2006 |
|
tfap2a |
Fig. 4 ![]() |
Phenotype
Phenotype resulting from MO2-sema3d
Phenotype of all Fish created by or utilizing MO2-sema3d
Citations