Morpholino

MO1-nphs1

ID
ZDB-MRPHLNO-051102-1
Name
MO1-nphs1
Previous Names
  • MO1-nphs1l
  • nephrinMO (1)
Target
Sequence
5' - CGCTGTCCATTACCTTTCAGGCTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nphs1
Expressed Gene Anatomy Figures
adcyap1a Fig. S2 from Eneman et al., 2017
dag1 Fig. 2 with image from Sohn et al., 2009
nphs1 Fig. 1 with image from Eneman et al., 2017
Fig. 2 with image from Sohn et al., 2009
Fig. 4 with image from Kramer-Zucker et al., 2005
vip Fig. S2 from Eneman et al., 2017
Phenotype
Phenotype resulting from MO1-nphs1
Phenotype Fish Figures
glomerular filtration disrupted, abnormal AB + MO1-nphs1 Fig. S8 from Schiffer et al., 2015
Fig. 7 from Nishibori et al., 2011
heart edematous, abnormal WT + MO1-nphs1 Fig. 3 from Arif et al., 2013
myotome decreased width, abnormal WT + MO1-nphs1 Fig. 2 with image from Sohn et al., 2009
myotome malformed, abnormal WT + MO1-nphs1 Fig. 2 with image from Sohn et al., 2009
myotome muscle cell decreased length, abnormal WT + MO1-nphs1 Fig. 2 with image from Sohn et al., 2009
pericardium edematous, abnormal la2Tg + MO1-nphs1 Fig. 1 with image from Eneman et al., 2017
post-vent region curved dorsal, abnormal WT + MO1-nphs1 Fig. 2 with image from Sohn et al., 2009
pronephros glomerular filtration decreased process quality, abnormal uf4Tg + MO1-nphs1 + MO4-tp53 Figure 3 with image from Riedmann et al., 2023
skeletal muscle cell nucleus mislocalised, abnormal WT + MO1-nphs1 Fig. 2 with image from Sohn et al., 2009
skeletal muscle fiber development process quality, abnormal WT + MO1-nphs1 Fig. 2 with image from Sohn et al., 2009
skeletal muscle tissue development process quality, abnormal WT + MO1-nphs1 Fig. 2 with image from Sohn et al., 2009
urine protein increased amount, abnormal uf4Tg + MO1-nphs1 + MO4-tp53 Figure 3 with image from Riedmann et al., 2023
whole organism dead, abnormal la2Tg + MO1-nphs1 Fig. 1 with image from Eneman et al., 2017
whole organism vip expression decreased amount, abnormal la2Tg + MO1-nphs1 Fig. S2 from Eneman et al., 2017
whole organism adcyap1a expression decreased amount, abnormal la2Tg + MO1-nphs1 Fig. S2 from Eneman et al., 2017
whole organism nphs1 expression decreased amount, abnormal la2Tg + MO1-nphs1 Fig. 1 with image from Eneman et al., 2017
whole organism decreased length, abnormal WT + MO1-nphs1 Fig. 2 with image from Sohn et al., 2009
whole organism morphology, abnormal la2Tg + MO1-nphs1 Fig. 1 with image from Eneman et al., 2017
Phenotype of all Fish created by or utilizing MO1-nphs1
Phenotype Fish Conditions Figures
glomerular filtration disrupted, abnormal AB + MO1-nphs1 standard conditions Fig. S8 from Schiffer et al., 2015
Fig. 7 from Nishibori et al., 2011
myotome malformed, abnormal WT + MO1-nphs1 standard conditions Fig. 2 with image from Sohn et al., 2009
skeletal muscle fiber development process quality, abnormal WT + MO1-nphs1 standard conditions Fig. 2 with image from Sohn et al., 2009
skeletal muscle cell nucleus mislocalised, abnormal WT + MO1-nphs1 standard conditions Fig. 2 with image from Sohn et al., 2009
post-vent region curved dorsal, abnormal WT + MO1-nphs1 standard conditions Fig. 2 with image from Sohn et al., 2009
whole organism decreased length, abnormal WT + MO1-nphs1 standard conditions Fig. 2 with image from Sohn et al., 2009
myotome muscle cell decreased length, abnormal WT + MO1-nphs1 standard conditions Fig. 2 with image from Sohn et al., 2009
skeletal muscle tissue development process quality, abnormal WT + MO1-nphs1 standard conditions Fig. 2 with image from Sohn et al., 2009
myotome decreased width, abnormal WT + MO1-nphs1 standard conditions Fig. 2 with image from Sohn et al., 2009
heart edematous, abnormal WT + MO1-nphs1 standard conditions Fig. 3 from Arif et al., 2013
whole organism morphology, abnormal la2Tg + MO1-nphs1 standard conditions Fig. 1 with image from Eneman et al., 2017
pericardium edematous, abnormal la2Tg + MO1-nphs1 standard conditions Fig. 1 with image from Eneman et al., 2017
whole organism nphs1 expression decreased amount, abnormal la2Tg + MO1-nphs1 standard conditions Fig. 1 with image from Eneman et al., 2017
whole organism vip expression decreased amount, abnormal la2Tg + MO1-nphs1 standard conditions Fig. S2 from Eneman et al., 2017
whole organism adcyap1a expression decreased amount, abnormal la2Tg + MO1-nphs1 standard conditions Fig. S2 from Eneman et al., 2017
whole organism dead, abnormal la2Tg + MO1-nphs1 standard conditions Fig. 1 with image from Eneman et al., 2017
pronephros glomerular filtration decreased process quality, abnormal uf4Tg + MO1-nphs1 + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
urine protein increased amount, abnormal uf4Tg + MO1-nphs1 + MO4-tp53 standard conditions Figure 3 with image from Riedmann et al., 2023
whole organism dead, exacerbated la2Tg + MO1-nphs1 + MO3-adcyap1a + MO3-adcyap1b standard conditions Fig. 4 with image from Eneman et al., 2017
pericardium edematous, exacerbated la2Tg + MO1-nphs1 + MO3-adcyap1a + MO3-adcyap1b standard conditions Fig. 4 with image from Eneman et al., 2017
whole organism morphology, exacerbated la2Tg + MO1-nphs1 + MO3-adcyap1a + MO3-adcyap1b standard conditions Fig. 4 with image from Eneman et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.