Morpholino
MO1-nphs1
- ID
- ZDB-MRPHLNO-051102-1
- Name
- MO1-nphs1
- Previous Names
-
- MO1-nphs1l
- nephrinMO (1)
- Target
- Sequence
-
5' - CGCTGTCCATTACCTTTCAGGCTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
splice-blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nphs1
Expressed Gene | Anatomy | Figures |
---|---|---|
adcyap1a |
Fig. S2
from Eneman et al., 2017 |
|
dag1 |
Fig. 2 ![]() |
|
nphs1 |
Fig. 1 ![]() Fig. 2 ![]() Fig. 4 ![]() |
|
vip |
Fig. S2
from Eneman et al., 2017 |
1 - 4 of 4
Phenotype
Phenotype resulting from MO1-nphs1
1 - 5 of 18 Show all
Phenotype of all Fish created by or utilizing MO1-nphs1
1 - 5 of 21 Show all
Citations
- Riedmann, H., Kayser, S., Helmstädter, M., Epting, D., Bergmann, C. (2023) Kif21a deficiency leads to impaired glomerular filtration barrier function. Scientific Reports. 13:1916119161
- Djenoune, L., Tomar, R., Dorison, A., Ghobrial, I., Schenk, H., Hegermann, J., Beverly-Staggs, L., Hidalgo-Gonzalez, A., Little, M.H., Drummond, I.A. (2021) Autonomous Calcium Signaling in Human and Zebrafish Podocytes Controls Kidney Filtration Barrier Morphogenesis. Journal of the American Society of Nephrology : JASN. 32(7):1697-1712
- Siegerist, F., Lange, T., Iervolino, A., Koppe, T.M., Zhou, W., Capasso, G., Endlich, K., Endlich, N. (2021) Evaluation of endogenous miRNA reference genes across different zebrafish strains, developmental stages and kidney disease models. Scientific Reports. 11:22894
- Eneman, B., Elmonem, M.A., van den Heuvel, L.P., Khodaparast, L., Khodaparast, L., van Geet, C., Freson, K., Levtchenko, E. (2017) Pituitary adenylate cyclase-activating polypeptide (PACAP) in zebrafish models of nephrotic syndrome. PLoS One. 12:e0182100
- Kotb, A.M., Simon, O., Blumenthal, A., Vogelgesang, S., Dombrowski, F., Amann, K., Zimmermann, U., Endlich, K., Endlich, N. (2016) Knockdown of ApoL1 in Zebrafish Larvae Affects the Glomerular Filtration Barrier and the Expression of Nephrin. PLoS One. 11:e0153768
- Schiffer, M., Teng, B., Gu, C., Shchedrina, V.A., Kasaikina, M., Pham, V.A., Hanke, N., Rong, S., Gueler, F., Schroder, P., Tossidou, I., Park, J.K., Staggs, L., Haller, H., Erschow, S., Hilfiker-Kleiner, D., Wei, C., Chen, C., Tardi, N., Hakroush, S., Selig, M.K., Vasilyev, A., Merscher, S., Reiser, J., Sever, S. (2015) Pharmacological targeting of actin-dependent dynamin oligomerization ameliorates chronic kidney disease in diverse animal models. Nature medicine. 21:601-9
- Arif, E., Kumari, B., Wagner, M.C., Zhou, W., Holzman, L.B., and Nihalani, D. (2013) Myo1c is an unconventional myosin required for zebrafish glomerular development. Kidney International. 84(6):1154-65
- Nishibori, Y., Katayama, K., Parikka, M., Oddsson, A., Nukui, M., Hultenby, K., Wernerson, A., He, B., Ebarasi, L., Raschperger, E., Norlin, J., Uhlén, M., Patrakka, J., Betsholtz, C., and Tryggvason, K. (2011) Glcci1 Deficiency Leads to Proteinuria. Journal of the American Society of Nephrology : JASN. 22(11):2037-46
- Sohn, R.L., Huang, P., Kawahara, G., Mitchell, M., Guyon, J., Kalluri, R., Kunkel, L.M., and Gussoni, E. (2009) A role for nephrin, a renal protein, in vertebrate skeletal muscle cell fusion. Proceedings of the National Academy of Sciences of the United States of America. 106(23):9274-9279
- Kramer-Zucker, A.G., Wiessner, S., Jensen, A.M., and Drummond, I.A. (2005) Organization of the pronephric filtration apparatus in zebrafish requires Nephrin, Podocin and the FERM domain protein Mosaic eyes. Developmental Biology. 285(2):316-329
1 - 10 of 10
Show