Morpholino
MO2-cxcr4b
- ID
- ZDB-MRPHLNO-051006-4
- Name
- MO2-cxcr4b
- Previous Names
- None
- Target
- Sequence
-
5' - AGTGTGCTCAAAAAGGCGCAATAAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cxcr4b
No data available
Phenotype
Phenotype resulting from MO2-cxcr4b
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO2-cxcr4b
1 - 5 of 8 Show all
Citations
- Staton, A.A., Knaut, H., and Giraldez, A.J. (2011) miRNA regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration. Nature Genetics. 43(3):204-211
- Palevitch, O., Abraham, E., Borodovsky, N., Levkowitz, G., Zohar, Y., and Gothilf, Y. (2010) Cxcl12a-Cxcr4b signaling is important for proper development of the forebrain GnRH system in zebrafish. General and comparative endocrinology. 165(2):262-268
- Hollway, G.E., Bryson-Richardson, R.J., Berger, S., Cole, N.J., Hall, T.E., and Currie, P.D. (2007) Whole-somite rotation generates muscle progenitor cell compartments in the developing zebrafish embryo. Developmental Cell. 12(2):207-219
- Knaut, H., Blader, P., Strähle, U., and Schier, A.F. (2005) Assembly of trigeminal sensory Ganglia by chemokine signaling. Neuron. 47(5):653-666
- Knaut, H., Werz, C., Geisler, R., The Tübingen 2000 Screen Consortium, Nüsslein-Volhard, C. (2003) A zebrafish homologue of the chemokine receptor Cxcr4 is a germ-cell guidance receptor. Nature. 421(6920):279-282
1 - 5 of 5
Show