Morpholino
MO1-kdrl
- ID
- ZDB-MRPHLNO-050906-2
- Name
- MO1-kdrl
- Previous Names
-
- MO-flk-1 (1)
- MO1-kdr
- Target
- Sequence
-
5' - CCGAATGATACTCCGTATGTCAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kdrl
No data available
Phenotype
Phenotype resulting from MO1-kdrl
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-kdrl
1 - 5 of 9 Show all
Citations
- Mitra, S., Devi, S., Lee, M.S., Jui, J., Sahu, A., Goldman, D. (2022) Vegf signaling between Müller glia and vascular endothelial cells is regulated by immune cells and stimulates retina regeneration. Proceedings of the National Academy of Sciences of the United States of America. 119:e2211690119e2211690119
- Tsao, K.C., Lin, Y.C., Chen, Y.T., Lai, S.L., Yang, R.B. (2021) Zebrafish scube1 and scube2 cooperate in promoting Vegfa signaling during embryonic vascularization. Cardiovascular research. 118(4):1074-1087
- Toselli, C.M., Wilkinson, B.M., Paterson, J., Kieffer, T.J. (2019) Vegfa/vegfr2 signaling is necessary for zebrafish islet vessel development, but is dispensable for beta-cell and alpha-cell formation. Scientific Reports. 9:3594
- Hasan, S.S., Tsaryk, R., Lange, M., Wisniewski, L., Moore, J.C., Lawson, N.D., Wojciechowska, K., Schnittler, H., Siekmann, A.F. (2017) Endothelial Notch signalling limits angiogenesis via control of artery formation. Nature cell biology. 19(8):928-940
- Hamm, M.J., Kirchmaier, B.C., Herzog, W. (2016) Sema3d controls collective endothelial cell migration by distinct mechanisms via Nrp1 and PlxnD1. The Journal of cell biology. 215(3):415-430
- Qiu, J., Fan, X., Wang, Y., Jin, H., Song, Y., Han, Y., Huang, S., Meng, Y., Tang, F., Meng, A. (2016) Embryonic hematopoiesis in vertebrate somites gives rise to definitive hematopoietic stem cells. Journal of molecular cell biology. 8(4):288-301
- Jensen, L.D., Nakamura, M., Bräutigam, L., Li, X., Liu, Y., Samani, N.J., Cao, Y. (2015) VEGF-B-Neuropilin-1 signaling is spatiotemporally indispensable for vascular and neuronal development in zebrafish. Proceedings of the National Academy of Sciences of the United States of America. 112(44):E5944-53
- Anton, H., Harlepp, S., Ramspacher, C., Wu, D., Monduc, F., Bhat, S., Liebling, M., Paoletti, C., Charvin, G., Freund, J.B., and Vermot, J. (2013) Pulse propagation by a capacitive mechanism drives embryonic blood flow. Development (Cambridge, England). 140(21):4426-34
- Ba, Q., Duan, J., Tian, J.Q., Wang, Z.L., Chen, T., Li, X.G., Chen, P.Z., Wu, S.J., Xiang, L., Li, J.Q., Chu, R.A., and Wang, H. (2013) Dihydroartemisinin promotes angiogenesis during the early embryonic development of zebrafish. Acta Pharmacologica Sinica. 34(8):1101-7
- Yin, C., Evason, K.J., Maher, J.J., and Stainier, D.Y. (2012) The basic helix-loop-helix transcription factor, heart and neural crest derivatives expressed transcript 2, marks hepatic stellate cells in zebrafish: Analysis of stellate cell entry into the developing liver. Hepatology (Baltimore, Md.). 56(5):1958-1970
1 - 10 of 15
Show