header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050902-3
Morpholino Name: MO2-bmp7a
Target: bmp7a (1)
Previous Name: MO2-bmp7 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCAATCCAGAGCAACATCCAGCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-bmp7a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-bmp7a
Expressed Gene Anatomy Figures
atp1b1b Fig. 8 with image from Hsiao et al., 2007
ca2 Fig. 8 with image from Hsiao et al., 2007
PHENOTYPE
Phenotype resulting from MO2-bmp7a
Phenotype of all Fish created by or utilizing MO2-bmp7a
OTHER MO2-bmp7a MORPHOLINO PAGESNo links to external sites
CITATIONS (6)