Morpholino

MO2-bmp2b

ID

ZDB-MRPHLNO-050902-2

Name

MO2-bmp2b

Previous Names

None

Target

Sequence

5' - GTCTGCGTTCCCGTCGTCTCCTAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-bmp2b

Expressed Gene	Anatomy	Figures
bmp2b	whole organism dorsal-ventral gradient	Fig. 3 from Sun et al., 2014
egr2b	presumptive rhombomere 3 presumptive rhombomere 5	Fig. 3 from Sun et al., 2014
eve1	tail bud	Fig. 3 from Sun et al., 2014
gata1a	lateral mesoderm mesoderm posterior region	Fig. 3 from Sun et al., 2014
hhex	posterior pancreatic bud	Fig. 4 from Chung et al., 2008

Phenotype

Phenotype resulting from MO2-bmp2b

Phenotype	Fish	Figures
caudal fin shortened, abnormal	WT + MO2-bmp2b	Fig. 3 from Gan et al., 2016
ceratobranchial cartilage absent, abnormal	WT + MO2-bmp2b	Fig. 5 from Gan et al., 2016
Meckel's cartilage decreased size, abnormal	WT + MO2-bmp2b	Fig. 5 from Gan et al., 2016
neuroectoderm wholly dorsalized, abnormal	WT + MO2-bmp2b	Fig. 3 from Sun et al., 2014
trunk curved, abnormal	WT + MO2-bmp2b	Fig. 3 from Gan et al., 2016
ventral fin fold absent, abnormal	WT + MO2-bmp2b	Fig. 3 from Sun et al., 2014
whole organism ab1-bmp2b labeling decreased amount, abnormal	WT + MO2-bmp2b	Fig. 3 from Gan et al., 2016
whole organism dorsalized, abnormal	WT + MO2-bmp2b	Fig. 7 from Holtzhausen et al., 2014
whole organism morphology, abnormal	WT + MO2-bmp2b	Fig. 3 from Gan et al., 2016

Phenotype of all Fish created by or utilizing MO2-bmp2b

Phenotype	Fish	Conditions	Figures
whole organism morphology, abnormal	WT + MO2-bmp2b	standard conditions	Fig. 3 from Gan et al., 2016
caudal fin shortened, abnormal	WT + MO2-bmp2b	standard conditions	Fig. 3 from Gan et al., 2016
whole organism ab1-bmp2b labeling decreased amount, abnormal	WT + MO2-bmp2b	standard conditions	Fig. 3 from Gan et al., 2016
Meckel's cartilage decreased size, abnormal	WT + MO2-bmp2b	standard conditions	Fig. 5 from Gan et al., 2016
ceratobranchial cartilage absent, abnormal	WT + MO2-bmp2b	standard conditions	Fig. 5 from Gan et al., 2016
trunk curved, abnormal	WT + MO2-bmp2b	standard conditions	Fig. 3 from Gan et al., 2016
ventral fin fold absent, abnormal	WT + MO2-bmp2b	standard conditions	Fig. 3 from Sun et al., 2014
whole organism dorsalized, abnormal	WT + MO2-bmp2b	standard conditions	Fig. 7 from Holtzhausen et al., 2014
neuroectoderm wholly dorsalized, abnormal	WT + MO2-bmp2b	standard conditions	Fig. 3 from Sun et al., 2014

Citations