ZFIN ID: ZDB-MRPHLNO-050818-3
Morpholino Name: MO4-fgf3
Target: fgf3 (1)
Sequence:
5' - CATTGTGGCATGGAGGGATGTCGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-fgf3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-fgf3
Expressed Gene Anatomy Figures
alcama Fig. 3 with image from Nechiporuk et al., 2005
foxi1 Fig. 5 with image from Nechiporuk et al., 2005
ins Fig. 3 from Song et al., 2007
neurog1 Fig. 3 with image from Nechiporuk et al., 2005
phox2a Fig. 3 with image from Nechiporuk et al., 2005
phox2bb Fig. S4 with image from Nechiporuk et al., 2007
Fig. 3 with image from Nechiporuk et al., 2005
PHENOTYPE
Phenotype resulting from MO4-fgf3
No data available

Phenotype of all Fish created by or utilizing MO4-fgf3
Phenotype Fish Conditions Figures
locus coeruleus morphology, abnormal WT + MO1-fgf8a + MO2-fgf8a + MO4-fgf3 standard conditions Fig. S4 with image from Nechiporuk et al., 2007
parasympathetic nervous system development disrupted, abnormal WT + MO1-fgf8a + MO2-fgf8a + MO4-fgf3 standard conditions Fig. S4 with image from Nechiporuk et al., 2007
epibranchial placode morphology, abnormal WT + MO1-fgf8a + MO2-fgf8a + MO4-fgf3 standard conditions Fig. S4 with image from Nechiporuk et al., 2007
locus ceruleus development disrupted, abnormal WT + MO1-fgf8a + MO2-fgf8a + MO4-fgf3 standard conditions Fig. S4 with image from Nechiporuk et al., 2007
OTHER MO4-fgf3 MORPHOLINO PAGESNo links to external sites
CITATIONS (6)