Morpholino
MO1-sox32
- ID
- ZDB-MRPHLNO-050818-2
- Name
- MO1-sox32
- Previous Names
-
- cas-MO (1)
- Target
- Sequence
-
5' - GCATCCGGTCGAGATACATGCTGTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sox32
Expressed Gene | Anatomy | Figures |
---|---|---|
alcama |
|
Fig. 1 ![]() |
fgf3 |
Fig. 4 ![]() Fig. 2 ![]() |
|
fgf8a |
Fig. 4 ![]() |
|
foxa3 |
Fig. 4 ![]() |
|
foxi1 | (all 9) |
Fig. 4 ![]() Fig. 5 ![]() |
1 - 5 of 17 Show all
Phenotype
Phenotype resulting from MO1-sox32
1 - 5 of 18 Show all
Phenotype of all Fish created by or utilizing MO1-sox32
1 - 5 of 32 Show all
Citations
- Petridou, N.I., Corominas-Murtra, B., Heisenberg, C.P., Hannezo, E. (2021) Rigidity percolation uncovers a structural basis for embryonic tissue phase transitions. Cell. 184(7):1914-1928.e19
- Dalgin, G., Prince, V.E. (2020) Midline morphogenesis of zebrafish foregut endoderm is dependent on Hoxb5b. Developmental Biology. 471:1-9
- Čapek, D., Smutny, M., Tichy, A.M., Morri, M., Janovjak, H., Heisenberg, C.P. (2019) Light-activated Frizzled7 reveals a permissive role of non-canonical Wnt signaling in mesendoderm cell migration. eLIFE. 8:
- Prummel, K.D., Hess, C., Nieuwenhuize, S., Parker, H.J., Rogers, K.W., Kozmikova, I., Racioppi, C., Brombacher, E.C., Czarkwiani, A., Knapp, D., Burger, S., Chiavacci, E., Shah, G., Burger, A., Huisken, J., Yun, M.H., Christiaen, L., Kozmik, Z., Müller, P., Bronner, M., Krumlauf, R., Mosimann, C. (2019) A conserved regulatory program initiates lateral plate mesoderm emergence across chordates. Nature communications. 10:3857
- Collins, M.M., Maischein, H.M., Dufourcq, P., Charpentier, M., Blader, P., Stainier, D.Y. (2018) Pitx2c orchestrates embryonic axis extension via mesendodermal cell migration. eLIFE. 7:
- Liu, Z., Woo, S., Weiner, O.D. (2018) Nodal signaling has dual roles in fate specification and directed migration during germ layer segregation. Development (Cambridge, England). 145(17):
- Barone, V., Lang, M., Krens, S.F.G., Pradhan, S.J., Shamipour, S., Sako, K., Sikora, M., Guet, C.C., Heisenberg, C.P. (2017) An Effective Feedback Loop between Cell-Cell Contact Duration and Morphogen Signaling Determines Cell Fate. Developmental Cell. 43(2):198-211.e12
- Krens, S.F.G., Veldhuis, J.H., Barone, V., Čapek, D., Maître, J.L., Brodland, G.W., Heisenberg, C.P. (2017) Interstitial fluid osmolarity modulates the action of differential tissue surface tension in progenitor cell segregation during gastrulation. Development (Cambridge, England). 144:1798-1806
- Smutny, M., Ákos, Z., Grigolon, S., Shamipour, S., Ruprecht, V., Čapek, D., Behrndt, M., Papusheva, E., Tada, M., Hof, B., Vicsek, T., Salbreux, G., Heisenberg, C.P. (2017) Friction forces position the neural anlage. Nature cell biology. 19(4):306-317
- Perez-Camps, M., Tian, J., Chng, S.C., Sem, K.P., Sudhaharan, T., Teh, C., Wachsmuth, M., Korzh, V., Ahmed, S., Reversade, B. (2016) Quantitative imaging reveals real-time Pou5f3-Nanog complexes driving dorsoventral mesendoderm patterning in zebrafish. eLIFE. 5
1 - 10 of 28
Show