Morpholino

MO1-scn8aa

ID
ZDB-MRPHLNO-050812-4
Name
MO1-scn8aa
Previous Names
  • 1.6 MO (1)
  • Nav1.6a MO (1)
Target
Sequence
5' - GGGTGCAGCCATGTTTTCATCCTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targeted to predicted translation start methionine
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-scn8aa
No data available
Phenotype
Phenotype resulting from MO1-scn8aa
Phenotype Fish Figures
dorsal root ganglion axon collateral mislocalised laterally, abnormal WT + MO1-scn8aa Fig. 4 with image from Wright et al., 2010
dorsal root ganglion neuron mislocalised ventrally, abnormal WT + MO1-scn8aa Fig. 2 with imageFig. 3 with imageFig. 4 with image from Wright et al., 2010
dorsal root ganglion neuron mobile, abnormal WT + MO1-scn8aa Fig. 4 with image from Wright et al., 2010
dorsal root ganglion neuron neural crest derived mislocalised ventrally, abnormal sb4Tg + MO1-scn8aa Fig. 1 with image from Wright et al., 2010
mechanoreceptor cell voltage-gated sodium channel complex decreased functionality, abnormal WT + MO1-scn8aa Fig. 10 from Pineda et al., 2005
neuron differentiation process quality, abnormal sb4Tg + MO1-scn8aa Fig. 1 with imageFig. 4 with image from Wright et al., 2010
neuron migration process quality, abnormal sb4Tg + MO1-scn8aa Fig. 2 with imageFig. 3 with image from Wright et al., 2010
Rohon-Beard neuron increased life span, abnormal WT + MO1-scn8aa Fig. 4 with image from Pineda et al., 2006
Rohon-Beard neuron membrane potential, abnormal WT + MO1-scn8aa Fig. 10 from Pineda et al., 2005
Rohon-Beard neuron present, abnormal WT + MO1-scn8aa Fig. 4 with image from Pineda et al., 2006
secondary motor neuron axon misrouted, abnormal WT + MO1-scn8aa Fig. 5 with imageFig. 6 with imageFig. 8 with image from Pineda et al., 2006
sensory perception of touch decreased magnitude, abnormal WT + MO1-scn8aa Fig. 6 with image from Wright et al., 2010
thigmotaxis decreased occurrence, abnormal WT + MO1-scn8aa Fig. 7 from Pineda et al., 2005
voltage-gated sodium channel activity amplitude, abnormal WT + MO1-scn8aa Fig. 6Fig. 10 from Pineda et al., 2005
whole organism movement behavioral quality, abnormal WT + MO1-scn8aa Fig. 7 from Pineda et al., 2005
Phenotype of all Fish created by or utilizing MO1-scn8aa
Phenotype Fish Conditions Figures
Rohon-Beard neuron present, abnormal WT + MO1-scn8aa standard conditions Fig. 4 with image from Pineda et al., 2006
voltage-gated sodium channel activity amplitude, abnormal WT + MO1-scn8aa standard conditions Fig. 6Fig. 10 from Pineda et al., 2005
secondary motor neuron axon misrouted, abnormal WT + MO1-scn8aa standard conditions Fig. 5 with imageFig. 6 with imageFig. 8 with image from Pineda et al., 2006
dorsal root ganglion neuron mislocalised ventrally, abnormal WT + MO1-scn8aa standard conditions Fig. 4 with image from Wright et al., 2010
neuron differentiation process quality, abnormal WT + MO1-scn8aa standard conditions Fig. 4 with image from Wright et al., 2010
Rohon-Beard neuron membrane potential, abnormal WT + MO1-scn8aa standard conditions Fig. 10 from Pineda et al., 2005
sensory perception of touch decreased magnitude, abnormal WT + MO1-scn8aa standard conditions Fig. 6 with image from Wright et al., 2010
dorsal root ganglion neuron mobile, abnormal WT + MO1-scn8aa standard conditions Fig. 4 with image from Wright et al., 2010
dorsal root ganglion axon collateral mislocalised laterally, abnormal WT + MO1-scn8aa standard conditions Fig. 4 with image from Wright et al., 2010
whole organism movement behavioral quality, abnormal WT + MO1-scn8aa standard conditions Fig. 7 from Pineda et al., 2005
thigmotaxis decreased occurrence, abnormal WT + MO1-scn8aa standard conditions Fig. 7 from Pineda et al., 2005
mechanoreceptor cell voltage-gated sodium channel complex decreased functionality, abnormal WT + MO1-scn8aa standard conditions Fig. 10 from Pineda et al., 2005
Rohon-Beard neuron increased life span, abnormal WT + MO1-scn8aa standard conditions Fig. 4 with image from Pineda et al., 2006
neuron migration process quality, abnormal rw0130aTg + MO1-scn8aa standard conditions Fig. 3 with image from Wright et al., 2010
dorsal root ganglion neuron mislocalised ventrally, abnormal rw0130aTg + MO1-scn8aa standard conditions Fig. 3 with image from Wright et al., 2010
neuron differentiation process quality, abnormal sb4Tg + MO1-scn8aa standard conditions Fig. 1 with image from Wright et al., 2010
neuron migration process quality, abnormal sb4Tg + MO1-scn8aa standard conditions Fig. 2 with image from Wright et al., 2010
dorsal root ganglion neuron mislocalised ventrally, abnormal sb4Tg + MO1-scn8aa standard conditions Fig. 2 with image from Wright et al., 2010
dorsal root ganglion neuron neural crest derived mislocalised ventrally, abnormal sb4Tg + MO1-scn8aa standard conditions Fig. 1 with image from Wright et al., 2010
Citations