Morpholino

MO1-tfap2b

ID
ZDB-MRPHLNO-050729-2
Name
MO1-tfap2b
Previous Names
  • ap2b-x5.1 (1)
Target
Sequence
5' - GCCATTTTTCGACTTCGCTCTGATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tfap2b
No data available
Phenotype
Phenotype resulting from MO1-tfap2b
No data available
Phenotype of all Fish created by or utilizing MO1-tfap2b
Phenotype Fish Conditions Figures
pronephros distal region clcnk expression decreased amount, abnormal tfap2ant30/nt30 + MO1-tfap2b standard conditions Fig. 3 with image from Chambers et al., 2019
pronephros distal region clcnk expression decreased distribution, abnormal tfap2ant30/nt30 + MO1-tfap2b standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased amount, abnormal tfap2ant30/nt30 + MO1-tfap2b standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased distribution, abnormal tfap2ant30/nt30 + MO1-tfap2b standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, exacerbated tfap2ant30/nt30 + MO1-tfap2b standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased amount, abnormal tfap2ant30/nt30 + MO1-tfap2b standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule early distal convoluted tubule development decreased occurrence, abnormal tfap2ant30/nt30 + MO1-tfap2b standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased amount, abnormal tfap2ant30/nt30 + MO1-tfap2b standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal tfap2ant30/nt30 + MO1-tfap2b standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal tfap2ant30/nt30 + MO1-tfap2b standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased amount, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephros distal region clcnk expression decreased amount, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephros distal region clcnk expression decreased distribution, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, exacerbated TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased amount, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased distribution, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, exacerbated TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased amount, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal TU + MO1-tfap2b + MO4-tfap2a standard conditions Fig. 3 with image from Chambers et al., 2019
Citations