Morpholino

MO1-tfap2b

ID

ZDB-MRPHLNO-050729-2

Name

MO1-tfap2b

Previous Names

ap2b-x5.1 (1)

Target

tfap2b (1)

Sequence

5' - GCCATTTTTCGACTTCGCTCTGATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tfap2b

Expressed Gene	Anatomy	Figures
clcnk	pronephric distal early tubule pronephric distal late tubule pronephros distal region	Fig. 3 from Chambers et al., 2019
dlx2a	mandibular arch skeleton pharyngeal arch 3-7 skeleton	Fig. 4 from Knight et al., 2005
fgf8a	ectoderm midbrain hindbrain boundary	Fig. 9 from Knight et al., 2005
fli1	cranial vasculature mandibular arch skeleton	Fig. 4 from Knight et al., 2005
gsc	mandibular arch skeleton otic vesicle symplectic	Fig. 4 from Knight et al., 2005
hoxa2b	hindbrain pharyngeal arch 2 skeleton pharyngeal arch 3-7 skeleton	Fig. 4 from Knight et al., 2005
il17rd	midbrain hindbrain boundary neural crest otic vesicle	Fig. 9 from Knight et al., 2005
nkx2.3	pharyngeal pouch	Fig. 7 from Knight et al., 2005
slc12a1	pronephric distal early tubule	Fig. 3 from Chambers et al., 2019
slc12a3	pronephric distal late tubule	Fig. 3 from Chambers et al., 2019
sox9a	(not) chondrocranium mandibular arch skeleton	Fig. 4 from Knight et al., 2005

Phenotype

Phenotype resulting from MO1-tfap2b

No data available

Phenotype of all Fish created by or utilizing MO1-tfap2b

Phenotype	Fish	Conditions	Figures
pronephros distal region clcnk expression decreased amount, abnormal	tfap2a^nt30/nt30 + MO1-tfap2b	standard conditions	Fig. 3 from Chambers et al., 2019
pronephros distal region clcnk expression decreased distribution, abnormal	tfap2a^nt30/nt30 + MO1-tfap2b	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased amount, abnormal	tfap2a^nt30/nt30 + MO1-tfap2b	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased distribution, abnormal	tfap2a^nt30/nt30 + MO1-tfap2b	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, exacerbated	tfap2a^nt30/nt30 + MO1-tfap2b	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased amount, abnormal	tfap2a^nt30/nt30 + MO1-tfap2b	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule early distal convoluted tubule development decreased occurrence, abnormal	tfap2a^nt30/nt30 + MO1-tfap2b	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased amount, abnormal	tfap2a^nt30/nt30 + MO1-tfap2b	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal	tfap2a^nt30/nt30 + MO1-tfap2b	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal	tfap2a^nt30/nt30 + MO1-tfap2b	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased amount, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephros distal region clcnk expression decreased amount, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephros distal region clcnk expression decreased distribution, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, exacerbated	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased amount, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule clcnk expression decreased distribution, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, exacerbated	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased amount, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal	TU + MO1-tfap2b + MO4-tfap2a	standard conditions	Fig. 3 from Chambers et al., 2019

Citations