Morpholino

MO1-runx1

ID

ZDB-MRPHLNO-050726-3

Name

MO1-runx1

Previous Names

None

Target

Sequence

5' - AGCGCTCTTACCGTATTTGGCGTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-runx1

Expressed Gene	Anatomy	Figures
eef1a1l1	whole organism	Fig. 2 from Gering et al., 2005
gfi1aa	ventral wall of dorsal aorta	Fig. 4 from Thambyrajah et al., 2016
gfi1ab	inner ear ventral wall of dorsal aorta	Fig. 6 from Thambyrajah et al., 2016
ikzf1	intermediate cell mass of mesoderm thymus	Fig. 2 from Gering et al., 2005
irf4a	(not) intermediate cell mass of mesoderm	Fig. 1 from Wang et al., 2015
myb	(not) hematopoietic multipotent progenitor cell (not) ventral wall of dorsal aorta	Fig. 4 from Thambyrajah et al., 2016
rag1	thymus	Fig. 2 from Gering et al., 2005
runx1	whole organism	Fig. 2 from Gering et al., 2005

Phenotype

Phenotype resulting from MO1-runx1

Phenotype	Fish	Figures
definitive hemopoiesis disrupted, abnormal	WT + MO1-runx1	Fig. 6 from Zhang et al., 2007
hematopoietic multipotent progenitor cell myb expression absent, abnormal	WT + MO1-runx1	Fig. 4 from Thambyrajah et al., 2016
hematopoietic stem cell decreased amount, abnormal	WT + MO1-runx1	Fig. 6 from Zhang et al., 2007
intermediate cell mass of mesoderm irf4a expression absent, abnormal	WT + MO1-runx1	Fig. 1 from Wang et al., 2015
ventral wall of dorsal aorta myb expression absent, abnormal	WT + MO1-runx1	Fig. 4 from Thambyrajah et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal	ioz1Tg; s896Tg + MO1-runx1	Fig. S1 from He et al., 2015

Phenotype of all Fish created by or utilizing MO1-runx1

Phenotype	Fish	Conditions	Figures
ventral wall of dorsal aorta myb expression absent, abnormal	WT + MO1-runx1	control	Fig. 4 from Thambyrajah et al., 2016
hematopoietic stem cell decreased amount, abnormal	WT + MO1-runx1	standard conditions	Fig. 6 from Zhang et al., 2007
intermediate cell mass of mesoderm irf4a expression absent, abnormal	WT + MO1-runx1	standard conditions	Fig. 1 from Wang et al., 2015
hematopoietic multipotent progenitor cell myb expression absent, abnormal	WT + MO1-runx1	control	Fig. 4 from Thambyrajah et al., 2016
definitive hemopoiesis disrupted, abnormal	WT + MO1-runx1	standard conditions	Fig. 6 from Zhang et al., 2007
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal	ioz1Tg; s896Tg + MO1-runx1	standard conditions	Fig. S1 from He et al., 2015
circulating cell erythroblast EGFP expression decreased amount, abnormal	gfi1aa^qmc551Gt/+ + MO1-runx1	control	Fig. 4 from Thambyrajah et al., 2016
ventral wall of dorsal aorta gfi1ab expression amount, ameliorated	gfi1aa^{qmc551Gt/qmc551Gt} + MO1-runx1	control	Fig. 6 from Thambyrajah et al., 2016
erythroblast EGFP expression decreased amount, abnormal	gfi1aa^qmc551Gt/+; sd2Tg + MO1-runx1	control	Fig. 4 from Thambyrajah et al., 2016

Citations