Morpholino

MO1-hsp70.3

ID

ZDB-MRPHLNO-050726-2

Name

MO1-hsp70.3

Previous Names

hsp70-MO2 (1)

Targets

hsp70.1 (1)
hsp70.3 (1)

Sequence

5' - ATGATTGATTTCAAGAAACTGCAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-hsp70.3

Expressed Gene	Anatomy	Figures
foxi1	non neural ectoderm	Fig 8 from Ye et al., 2019
otx2b	neuroectoderm	Fig 8 from Ye et al., 2019
szl	whole organism ventral region	Fig 7 , Fig 8 from Ye et al., 2019
ved	whole organism ventral region	Fig 8 from Ye et al., 2019

Phenotype

Phenotype resulting from MO1-hsp70.3

No data available

Phenotype of all Fish created by or utilizing MO1-hsp70.3

Phenotype	Fish	Conditions	Figures
whole organism ventral region szl expression decreased amount, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region ved expression decreased amount, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region ved expression decreased distribution, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
non neural ectoderm foxi1 expression decreased distribution, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
neuroectoderm otx2b expression increased distribution, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
non neural ectoderm foxi1 expression decreased amount, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
neuroectoderm otx2b expression increased amount, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region szl expression decreased amount, abnormal	marcksb^{ihb199/ihb199} + MO1-hsp70.3	standard conditions	Fig 7 from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal	marcksb^{ihb199/ihb199} + MO1-hsp70.3	standard conditions	Fig 7 from Ye et al., 2019
whole organism ventral region szl expression decreased amount, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region ved expression decreased amount, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
whole organism spindle-shaped, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
non neural ectoderm foxi1 expression decreased amount, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
neuroectoderm otx2b expression increased amount, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region ved expression decreased distribution, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
non neural ectoderm foxi1 expression decreased distribution, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
neuroectoderm otx2b expression increased distribution, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019

Citations